ID: 924748272

View in Genome Browser
Species Human (GRCh38)
Location 1:246859361-246859383
Sequence CCCATTTACTAGTGTTCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924748268_924748272 2 Left 924748268 1:246859336-246859358 CCCACCAATTCTAGGTGAAGTCT 0: 1
1: 0
2: 0
3: 8
4: 118
Right 924748272 1:246859361-246859383 CCCATTTACTAGTGTTCCCCTGG 0: 1
1: 0
2: 0
3: 5
4: 95
924748270_924748272 -2 Left 924748270 1:246859340-246859362 CCAATTCTAGGTGAAGTCTCTCC 0: 1
1: 0
2: 0
3: 13
4: 152
Right 924748272 1:246859361-246859383 CCCATTTACTAGTGTTCCCCTGG 0: 1
1: 0
2: 0
3: 5
4: 95
924748269_924748272 1 Left 924748269 1:246859337-246859359 CCACCAATTCTAGGTGAAGTCTC 0: 1
1: 0
2: 0
3: 11
4: 95
Right 924748272 1:246859361-246859383 CCCATTTACTAGTGTTCCCCTGG 0: 1
1: 0
2: 0
3: 5
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924748272 Original CRISPR CCCATTTACTAGTGTTCCCC TGG Intronic
902646636 1:17804251-17804273 CCCATTTGCTCGTGTTCAGCTGG - Intronic
908332006 1:63080569-63080591 CTCCCTTACTAGTGTTCCCTGGG - Intergenic
910629801 1:89343007-89343029 TCCATTTGCCAGTCTTCCCCTGG - Intergenic
918778641 1:188668711-188668733 TCCATTTGCCAGTCTTCCCCAGG - Intergenic
920078464 1:203354366-203354388 CTCATTTAAAAGTGTTTCCCAGG - Intergenic
923327625 1:232894865-232894887 CCCATTTTCTACTGTTCCATTGG + Intergenic
924748272 1:246859361-246859383 CCCATTTACTAGTGTTCCCCTGG + Intronic
1064521961 10:16211813-16211835 TCCTTTTACTATTTTTCCCCCGG - Intergenic
1064578046 10:16765979-16766001 TCCCTTTACTTTTGTTCCCCTGG - Intronic
1067046957 10:42990374-42990396 CTCATTTTCTAGAGTTCCCCTGG - Intergenic
1068749228 10:60572624-60572646 TCCATTTACGGGTGCTCCCCAGG + Intronic
1069691167 10:70353894-70353916 GCAATATACTAGTGTTCCCAGGG - Intronic
1071208426 10:83311056-83311078 GCCATTTAATAGTGTTTGCCTGG + Intergenic
1079145818 11:17850853-17850875 CCCATTTACAATTGCCCCCCTGG - Intronic
1079934211 11:26597360-26597382 CCCAGTGACTAGTGTTCAGCTGG + Intronic
1086137590 11:83457553-83457575 TCCATTTACTAGTGTTGCTGTGG - Intronic
1088484598 11:110328577-110328599 CCCAGTGACTAGTGTTCAGCTGG + Intergenic
1091195500 11:133727485-133727507 CCCATTCACTGGTTTTCACCTGG + Intergenic
1093850843 12:24036006-24036028 CCCATTCTCTAGGGTTCTCCTGG - Intergenic
1095695511 12:45139231-45139253 CCCATTTCCTCTTCTTCCCCTGG - Intergenic
1099292648 12:80790247-80790269 CCCAGTGACTAGTGTTCAGCTGG - Intergenic
1099321646 12:81158177-81158199 CCCTTTAACCAGTTTTCCCCAGG - Intronic
1099437351 12:82659952-82659974 CCCTTTTACTTGTGTGCCCGTGG - Intergenic
1101331105 12:103758621-103758643 CACATTTGCTAATGTGCCCCTGG + Intronic
1104721987 12:131049603-131049625 CCCATTAACCAGTGCTCGCCAGG - Intronic
1106199692 13:27526060-27526082 CCCATTTGCTTCTGTGCCCCTGG + Intergenic
1109030310 13:57181524-57181546 CCCATTTGCCAGACTTCCCCAGG + Intergenic
1109931327 13:69222185-69222207 CCCAGTGACTAGTGTTCAGCTGG - Intergenic
1111545825 13:89734650-89734672 CCCATTGACTTGTGTCCCCCTGG + Intergenic
1113279899 13:108777786-108777808 CACGTTTACCTGTGTTCCCCAGG + Intronic
1115199558 14:30838417-30838439 CCCATGTACTGTGGTTCCCCTGG - Intergenic
1115816392 14:37168784-37168806 GCTATTTCCTTGTGTTCCCCTGG - Intronic
1122954523 14:105064357-105064379 CCAATTTGATAGTGTTGCCCAGG + Intronic
1126696554 15:51330664-51330686 CCCAACTGCTAGTGTTCTCCAGG - Intronic
1127854755 15:62945253-62945275 CCCATTTATCAGAGGTCCCCAGG - Intergenic
1129004553 15:72361355-72361377 CCAATGTACTAATGTTACCCAGG + Intronic
1131673880 15:94651312-94651334 CCCAGTGACTAGTGTTCAGCTGG - Intergenic
1134053669 16:11155808-11155830 TCCATTTGCTTGTGTTCGCCAGG - Intronic
1139223092 16:65204679-65204701 CCTATTTAAAAATGTTCCCCAGG + Intergenic
1141547536 16:84781282-84781304 CCCACTTCCTAGTATTCCGCCGG + Intergenic
1143765669 17:9136019-9136041 CCCATTTCCTCGTGTCCCCCTGG + Intronic
1155839297 18:30627398-30627420 TCCATTTGCCAGTCTTCCCCTGG + Intergenic
1156650132 18:39216017-39216039 CCCATTCACTTCTGTACCCCAGG + Intergenic
1159720493 18:71883917-71883939 CCTATTTACTAGTTTTCCGAGGG - Intergenic
1164255930 19:23528240-23528262 CATATTTACTTGTGTTCACCAGG - Intronic
930258754 2:49120933-49120955 CCAAATCACTAGTGTTCTCCTGG - Intronic
930752086 2:54944146-54944168 CCCATTGGCTAGTGATTCCCAGG + Intronic
932918211 2:75879265-75879287 CCCAGTGACTAGTGTTCAGCTGG - Intergenic
937259761 2:120577917-120577939 GCTATTTGCTCGTGTTCCCCTGG - Intergenic
938224801 2:129606498-129606520 CCCGTGAACTTGTGTTCCCCAGG + Intergenic
942631087 2:177950260-177950282 TCAATTTGCTAGAGTTCCCCAGG + Intronic
942818733 2:180084495-180084517 CCCATTTACTAGGGCACCCCAGG - Intergenic
945220722 2:207481139-207481161 GCCATTTACTAGTGTAACCAAGG - Intergenic
1179120806 21:38544038-38544060 ACTATTCAATAGTGTTCCCCAGG - Intronic
1182478176 22:30588244-30588266 CCCATTTACTGTTGTTTTCCAGG - Intronic
1183387600 22:37524104-37524126 CCCATTGCCCAGTGTCCCCCGGG + Intergenic
951954995 3:28243716-28243738 CCTATGTACTACTGTTCCCTAGG - Intronic
954911022 3:54109573-54109595 TTCTTTTACTATTGTTCCCCAGG + Intergenic
962853637 3:139325972-139325994 CCCATTTAACAGTCTTCCCAAGG - Intronic
963323032 3:143830086-143830108 CAGATTAACTAGTGTCCCCCAGG + Intronic
963761974 3:149293651-149293673 TCCATTTGCCAGTTTTCCCCTGG - Intergenic
964823237 3:160796694-160796716 CCCCTTTACTAGCTTTCTCCTGG + Intronic
967160056 3:186727963-186727985 CCCATTTCCTTTTCTTCCCCAGG + Intronic
976942878 4:90728084-90728106 CCCATTGACTACTGCTTCCCTGG + Intronic
980610958 4:135162873-135162895 CATATTCACTAGTTTTCCCCTGG - Intergenic
983259575 4:165441142-165441164 CCCATTTATGACTGTTTCCCTGG + Intronic
985840011 5:2298988-2299010 CCCAGTGCCTATTGTTCCCCTGG - Intergenic
987319868 5:16758622-16758644 CCCTGTAATTAGTGTTCCCCAGG - Intronic
990119922 5:52438540-52438562 TCAATTTGCTAGAGTTCCCCAGG - Intergenic
991878684 5:71200809-71200831 CCTATTTATTATTGTTTCCCAGG - Intergenic
999932010 5:156443789-156443811 CCCATGTGCCAGTGTTCCACTGG + Intronic
999948170 5:156619922-156619944 CCCATTAACCACTGTTCCCAGGG - Intronic
1000817014 5:165936101-165936123 CCCATTTGCTAGCATTGCCCAGG + Intergenic
1000961387 5:167605501-167605523 CCCAGTGAGAAGTGTTCCCCTGG + Intronic
1013342708 6:109230617-109230639 CCCATTTAAAAGAGTTCTCCGGG - Intergenic
1013600710 6:111702034-111702056 TCCATTTTCTATTGTTCTCCAGG - Intronic
1014999060 6:128191957-128191979 CCCATTTCCCTGTGTTTCCCTGG - Intronic
1019481166 7:1267485-1267507 CCCCTTGACTGGTGCTCCCCAGG - Intergenic
1021247569 7:18282707-18282729 CTCATTTATTATTTTTCCCCCGG - Intronic
1021681312 7:23135964-23135986 CACATTTGCTAATGTTCCACAGG - Intronic
1024562795 7:50658736-50658758 CCCAACTACTAGTGTTTCTCCGG - Intronic
1026371295 7:69702283-69702305 CCCTTTTATTTGTGTTTCCCAGG - Intronic
1030535686 7:110763553-110763575 CCCATTTAGTAGTGTTCAGGTGG - Intronic
1030680666 7:112430583-112430605 TCTATTTTCTAGTGTTCCCAGGG - Intronic
1040499211 8:47992483-47992505 TCTATTTGCCAGTGTTCCCCTGG + Intergenic
1047190808 8:122677628-122677650 CCCATTTATTTATGTTCCTCTGG + Intergenic
1049542539 8:143215113-143215135 CCCACTTACCGGTGTTCCCGTGG - Intergenic
1052575071 9:30281263-30281285 ACCATTTGCCAGTGTTCCCCTGG + Intergenic
1053595690 9:39558619-39558641 CCCATTTAATTGTGTTCCTAAGG - Intergenic
1053853656 9:42315249-42315271 CCCATTTAATTGTGTTCCTAAGG - Intergenic
1054570565 9:66806382-66806404 CCCATTTAATTGTGTTCCTAAGG + Intergenic
1056458955 9:86790994-86791016 CCCATTTCCTAGGATTCCACGGG + Intergenic
1186239062 X:7546806-7546828 TCCATTCACTAGGGTCCCCCGGG - Intergenic
1187613850 X:20972028-20972050 CCCAGTGACTAGTGTTCAGCTGG - Intergenic
1188022999 X:25178744-25178766 CCCATTTACATGTGTTTGCCAGG - Intergenic
1192253212 X:69430966-69430988 CCCATTTCCCAGAGTTTCCCTGG - Intergenic
1192366321 X:70476657-70476679 CACATTTACTTTTGTTCCCAAGG - Intronic
1196287247 X:113897297-113897319 CCCAGTGACTAGTGTTCAGCTGG + Intergenic
1198132902 X:133716678-133716700 CACACTTACTGGTGTTCCACAGG - Intronic
1199268525 X:145856055-145856077 CTCAGTCACAAGTGTTCCCCTGG + Intergenic
1199596415 X:149509643-149509665 TCCATTTACTACTGTATCCCAGG + Intronic