ID: 924748404

View in Genome Browser
Species Human (GRCh38)
Location 1:246860478-246860500
Sequence CTTTCTAAGCTGAAGGAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 176}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924748401_924748404 4 Left 924748401 1:246860451-246860473 CCTACTCATGAAACAATGTAAGC 0: 1
1: 0
2: 0
3: 9
4: 113
Right 924748404 1:246860478-246860500 CTTTCTAAGCTGAAGGAGTAAGG 0: 1
1: 0
2: 2
3: 15
4: 176
924748400_924748404 20 Left 924748400 1:246860435-246860457 CCTCTGAAATCTCGTACCTACTC 0: 1
1: 0
2: 0
3: 4
4: 64
Right 924748404 1:246860478-246860500 CTTTCTAAGCTGAAGGAGTAAGG 0: 1
1: 0
2: 2
3: 15
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924748404 Original CRISPR CTTTCTAAGCTGAAGGAGTA AGG Intronic
900811590 1:4805878-4805900 CTTTCTAAATGGAAGCAGTAGGG - Intergenic
901689195 1:10961394-10961416 CTTCTTAACCTGAAGGAGCAGGG - Intronic
903115236 1:21173875-21173897 TTTTCTACCCTGAGGGAGTATGG - Intronic
904992183 1:34601982-34602004 CTTTTTAAGGCAAAGGAGTAAGG - Intergenic
906133100 1:43473613-43473635 CCTTCTCAGCTGACAGAGTAAGG - Intergenic
906174291 1:43756746-43756768 CCATCTAAGCACAAGGAGTAAGG + Intronic
907118229 1:51988465-51988487 CTTTCCAATCTGGAGGAGGAAGG - Intronic
908005953 1:59729804-59729826 CTGTCTCACCTAAAGGAGTAGGG - Intronic
911085198 1:93971163-93971185 CTTTCTAAGCTGTAGAAGGAAGG + Intergenic
911257380 1:95647725-95647747 CCTTCTAAGGTGAAGGATAAGGG - Intergenic
913478641 1:119263317-119263339 CTTTTTAAGCAGTAGCAGTATGG + Intergenic
915713162 1:157920408-157920430 CCTTCAGAGCTGAAGGAGCAAGG - Intergenic
919946870 1:202325917-202325939 ATTCCTAACCTGAAGGAATAAGG - Intergenic
920302920 1:205000403-205000425 CTTTTGAAGCTGGAGGAGAATGG - Intronic
923352384 1:233121880-233121902 CATTCTCAGCTGAAAGAGCAAGG - Intronic
924748404 1:246860478-246860500 CTTTCTAAGCTGAAGGAGTAAGG + Intronic
1063355756 10:5396746-5396768 AATTCTAAGGTGGAGGAGTAGGG - Intronic
1063447248 10:6127129-6127151 TTTTCCAGGCTGAAGGAGTTGGG - Intergenic
1065094489 10:22267199-22267221 CTGTCTAGGCTGAAGGAATAAGG + Intergenic
1066444820 10:35472470-35472492 CCTTCTAAGTTGAAGGTATAAGG - Intronic
1067257120 10:44652176-44652198 CTTTGTAAACTGATGAAGTAGGG + Intergenic
1070377875 10:75851827-75851849 CTTAGAAAGCTGAAGGAGTACGG + Intronic
1071368805 10:84929242-84929264 GATTCTAAGATGAAGTAGTATGG - Intergenic
1071696248 10:87875393-87875415 TTTTTTAATCAGAAGGAGTATGG + Intronic
1072904951 10:99444546-99444568 CTGACTAAGCTGCAGGAGAAGGG + Intergenic
1073458238 10:103650584-103650606 CTGGCAAAGCTGAAGGAGGAAGG - Intronic
1073917620 10:108425032-108425054 CTTGCTAAGATGGAGGAGTCAGG + Intergenic
1083705749 11:64513404-64513426 ACTTCAGAGCTGAAGGAGTAAGG - Intergenic
1085373494 11:76035396-76035418 CTTTCTAAGATGATGCAGTTTGG + Intronic
1086151075 11:83611741-83611763 CTTTGTCCGCTGAAGCAGTAAGG + Intronic
1089073094 11:115716366-115716388 CTTTCTAAGGGGAAGGAGAGAGG + Intergenic
1090468564 11:126957637-126957659 GTTTCTAAGATGAAGGAGGCAGG + Intronic
1090974095 11:131667299-131667321 CTTTCTAGGCAGAAGGAGTAAGG - Intronic
1091067568 11:132530531-132530553 CATTCTGGGGTGAAGGAGTAAGG - Intronic
1091844225 12:3643018-3643040 CTTTCAAAGCAGAATGAGTTTGG + Intronic
1091885276 12:4012669-4012691 CCTTCTAAGGTTAAGGAGGAAGG - Intergenic
1092232903 12:6787058-6787080 CTTTCTAGTCTGAAGGAAGAAGG + Intronic
1093340584 12:17968169-17968191 CCTTCTAAGCTGACAGAGCAAGG + Intergenic
1097092521 12:56518524-56518546 GTGTCCAAGGTGAAGGAGTAGGG - Intergenic
1099852606 12:88121362-88121384 CCTTCTTAGCTGAAGGGGTATGG + Intronic
1101751335 12:107584980-107585002 CTTTGGAAGGTGAAGGAGTGGGG + Intronic
1111961635 13:94816912-94816934 TTTTAAAAGCTGAAGGAGAAAGG - Intergenic
1112708367 13:102098714-102098736 CTCTCCAAAATGAAGGAGTAGGG - Intronic
1114206879 14:20580285-20580307 CTTTGAAACCTGAAGGATTAAGG + Intergenic
1114296441 14:21333778-21333800 CTGTCTCAACTGAAAGAGTACGG - Intronic
1114350440 14:21844566-21844588 CTTTCTAGGATGAATGAGGAGGG + Intergenic
1114842738 14:26284507-26284529 TTTTCAAATCTGAAGGAGAAAGG + Intergenic
1114928293 14:27433417-27433439 CTTTCTTAGCTAATGGAGAAGGG + Intergenic
1119187954 14:72657594-72657616 TTTTCTAAGCTTCAGGACTATGG - Intronic
1119468282 14:74876681-74876703 CTTCTCAAGCTGAAGGAGGAGGG - Intergenic
1123162142 14:106288937-106288959 CTTTCTCAGCTGCAGGAGGCGGG - Intergenic
1123180264 14:106463103-106463125 CTTTCTCAGCTGCAGGAGGCGGG - Intergenic
1124046834 15:26158273-26158295 CTTTCTGAGTTGCAGGAGCAGGG + Intergenic
1126706546 15:51411219-51411241 CTTTATAAGCTGGAGGTGTAAGG - Intergenic
1126815092 15:52446628-52446650 TTTTCTAGGCTGAAGGTGCAAGG - Intronic
1127869902 15:63063107-63063129 CTTTATATCCTGAAGGAGGAGGG + Intronic
1130722820 15:86406115-86406137 CTATGGGAGCTGAAGGAGTAGGG + Intronic
1131359695 15:91779983-91780005 CTTTCTTACTTGGAGGAGTAAGG - Intergenic
1135937153 16:26791266-26791288 CTCTCTAAGTTGAAGAAATAAGG - Intergenic
1136563212 16:31053479-31053501 CTTTCTAAACTGAAAGAGGGTGG - Intergenic
1137390598 16:48078257-48078279 CTTTCTGATCTTAAGCAGTAGGG + Intergenic
1139803602 16:69544609-69544631 GTTTCTAAGGGGAAGGAGAAAGG + Intergenic
1146483624 17:33225632-33225654 CTTTCTGAGCTGTAAGATTAGGG - Intronic
1146749572 17:35366095-35366117 CTTTTTAATTTGAAGGAGGATGG - Intronic
1146953036 17:36919908-36919930 CTTTCTAAGCTCAAAGACCAAGG - Intergenic
1148565840 17:48632453-48632475 CTTGCTTAGCTGGAGGAGTTGGG - Intronic
1151718659 17:75843940-75843962 CTTCTGAAGCTGGAGGAGTAGGG + Intronic
1153277081 18:3378049-3378071 CTATCTGAGCTGAAGGAATAAGG - Intergenic
1155738267 18:29251789-29251811 GTTTCTAATATGAAGGAGCAAGG + Intergenic
1155834033 18:30556182-30556204 TTTTCTACTCTGAAGGAGTTTGG + Intergenic
1158112902 18:53961590-53961612 CTTTCTAAGCTGTATGATTATGG - Intergenic
1158689121 18:59644417-59644439 CTTTGTAAGCTGAAGAAGACAGG - Intronic
1159302334 18:66590849-66590871 CCTTGTAAGATGAAGGAGCATGG + Intronic
1160303439 18:77707048-77707070 CTTACTATGCTGAAGGATGAAGG - Intergenic
1160337232 18:78053592-78053614 CTCACTCAGCTGAAGGAGCAAGG + Intergenic
1160395239 18:78566039-78566061 TTTTCTAAGAGGAAGGCGTAGGG + Intergenic
1162597882 19:11642970-11642992 CTTTATTAGCTGAATGAGAACGG + Intergenic
1164975008 19:32566406-32566428 CTTTCTGGGCTCAAGGAGCATGG - Intergenic
1166676567 19:44745026-44745048 CTTTCTAAGAGGAGAGAGTAGGG - Intergenic
1167900457 19:52617807-52617829 CTTTCTAACCTGTTGGAGCAAGG - Intronic
925056908 2:863323-863345 ATTTCTAAGATGAGGGAGTGGGG - Intergenic
925616780 2:5751331-5751353 CATTCTGAGCTCTAGGAGTACGG - Intergenic
926598485 2:14816140-14816162 CTGTGTAAGCTAAAGGAGTTTGG - Intergenic
927199708 2:20570790-20570812 CTCTCTGAGCTGGAGGAGTTTGG + Intronic
931632933 2:64317362-64317384 CTTTCCAAGGTGAGGGAGTGAGG + Intergenic
931861016 2:66354566-66354588 CTTGCTGAGCTGAAGAAGCAGGG - Intergenic
935891149 2:107679862-107679884 CTTTATAGGCAGAATGAGTAGGG + Intergenic
936630622 2:114199018-114199040 CTTTCCAGGCTGAGGGAGAAAGG - Intergenic
938752046 2:134341743-134341765 CTGGCTGAGCTCAAGGAGTAAGG + Exonic
939352075 2:141051638-141051660 CTTTCTCAGTTGGAGGAGAATGG - Intronic
939751963 2:146058914-146058936 ACTTCTCAGCTGAAGGAATAAGG - Intergenic
940813430 2:158271933-158271955 ATTTCTAAGCTAAAGTAGTTAGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
943187413 2:184629415-184629437 TTTTCTAAATTGAAGAAGTAGGG + Intronic
947969919 2:234314504-234314526 CTTCCTAAGCTATAGGAATATGG - Intergenic
1171168952 20:22998359-22998381 CTTTCTATGCTTAAGGATTCAGG + Intergenic
1171507168 20:25646931-25646953 CTTTCTCAGTTGAAGGGGAAAGG + Intergenic
1173222485 20:41141293-41141315 CCCTCTGAGGTGAAGGAGTATGG + Intronic
1173628153 20:44489113-44489135 CTTTCTGGGCTGAAAAAGTAAGG + Intronic
1174750627 20:53107875-53107897 CTTTCTTAACTGAAGGACTTGGG - Intronic
1174925857 20:54759213-54759235 CTTTCTAAGCAGAAGTATTTAGG - Intergenic
1175486149 20:59347950-59347972 CTATCTCAGCTGACAGAGTAAGG + Intergenic
1177163838 21:17578354-17578376 CTTTCTAAGTGAAAGGTGTATGG + Intronic
1180556531 22:16582551-16582573 CTTTCTGAGCTGAATGGGTGAGG + Intergenic
1183717746 22:39543751-39543773 CTTTCTGAGCAGGAGGAGTGGGG - Intergenic
949573155 3:5312598-5312620 CTTTCCATGCAGAAGGAGGAAGG - Intergenic
951272877 3:20649053-20649075 ATTACTAAGATGAAGGAGAATGG - Intergenic
952014768 3:28943219-28943241 CTTCCGAAGTTGAAGGAGGAAGG - Intergenic
956814597 3:72896546-72896568 CATTAAAAGCTGAAGGAGTGTGG + Intronic
956937246 3:74117085-74117107 CATTCTAGGCAGAAGGAGCAGGG - Intergenic
957199933 3:77120857-77120879 GTTTCTAAGGGTAAGGAGTATGG - Intronic
957773333 3:84722142-84722164 CTTTTTCAGCTGAAAGATTATGG + Intergenic
957798325 3:85041593-85041615 CTTTCTAACTTCAAGGAGTGAGG + Intronic
958029979 3:88096975-88096997 CTTTCTATGCTGATGGGGAAAGG - Intronic
959336810 3:105077615-105077637 CTCTCTGAGCTGAAGGGGTGGGG - Intergenic
959905881 3:111710850-111710872 CTTACAAATCTGCAGGAGTAAGG + Intronic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
962463983 3:135639745-135639767 CTTTCTGAGCTGCAGTAGTCTGG + Intergenic
962538094 3:136349717-136349739 ATTTCTAAGATGGTGGAGTAAGG + Intronic
963922584 3:150919985-150920007 CTTACTAAGTTGAATGACTATGG - Intronic
966736190 3:183189009-183189031 CTTTCTAACCTGAAGGGGTCTGG + Intronic
971806650 4:31367007-31367029 CTCTGTAAGATGAAGGAGGAAGG + Intergenic
973200820 4:47500202-47500224 ATTTCTACGCTGATGGAGGAGGG + Intronic
976235806 4:82895550-82895572 CTTTAAAAGCTGGAAGAGTAAGG + Intronic
976813035 4:89117653-89117675 CTAGCCAAGCAGAAGGAGTAGGG + Intergenic
976846571 4:89495373-89495395 CATTCCAAGCTCAAGGAGTCAGG - Intergenic
980763719 4:137270810-137270832 CCATCAAAGCTGTAGGAGTAAGG - Intergenic
984290399 4:177787206-177787228 AGTTCTAAGTGGAAGGAGTAGGG + Intronic
985812447 5:2099646-2099668 CTTTCTATGCAGGAGGAGTGGGG - Intergenic
988717223 5:33840318-33840340 CTTCCTAAACAGAAGTAGTAAGG - Intronic
990306075 5:54495026-54495048 CTTTCTCAACAGATGGAGTAGGG + Intergenic
990336358 5:54776568-54776590 CTTTCTTAGCAGAATGAGAATGG - Intergenic
990927679 5:61046990-61047012 CTTTCTAGGCAGAAGAAGTATGG + Intronic
992334022 5:75746926-75746948 GTTTCTTAGCTGTGGGAGTAGGG + Intergenic
992857679 5:80879730-80879752 GTTTCTAAGCTGAAGGAGTTTGG - Intergenic
993147960 5:84120502-84120524 CTGTGTCATCTGAAGGAGTAAGG - Intronic
995197089 5:109383186-109383208 CTTTCCAAGCTAAATGGGTATGG + Intronic
995981001 5:118104183-118104205 CTTTATATGCTGAAGGAAAAAGG + Intergenic
996518930 5:124404866-124404888 CTTTCTTAATTGAAGGACTATGG + Intergenic
997131512 5:131281708-131281730 CTTTCCAAGCTAAATGACTATGG - Intronic
997976426 5:138444249-138444271 CTTTCTAATCTGAAAGGGTCTGG - Intronic
998437009 5:142119033-142119055 CCTTCTAAGCTGACAGAGCAAGG + Intronic
998580956 5:143375100-143375122 CTTTCTCAGCCGAAAGAGTGAGG - Intronic
998748390 5:145288632-145288654 CTTTCTTAGCTGACAGAGCAAGG + Intergenic
999068677 5:148718850-148718872 GTTTCTATTCTGAAGGAGGAAGG - Intergenic
999930399 5:156426262-156426284 TCCTCTAAGCTGGAGGAGTAAGG + Intronic
1000644092 5:163740078-163740100 CCTTCTCAGCTGATGGATTAAGG + Intergenic
1000950050 5:167470565-167470587 CTTTCTGAACTGTAGGATTAAGG + Intronic
1001771656 5:174301526-174301548 CTTTCTGAGCTGGAAGAGTCTGG - Intergenic
1003837656 6:10088963-10088985 GTTTAGAAGCTGAAGGAGAAAGG - Intronic
1004911492 6:20289567-20289589 CATTGTAAGCTGGAAGAGTACGG + Intergenic
1011192664 6:84749120-84749142 CTTTCAAGGCTGATGGGGTAGGG + Intronic
1011634317 6:89356213-89356235 TTTTCTAAGCAGGAGGATTATGG - Intergenic
1016005007 6:139080173-139080195 CTTTCTAATCAGAAGGAGGAGGG + Intergenic
1016994426 6:149951680-149951702 CTTAATAGGATGAAGGAGTAGGG - Intergenic
1017784625 6:157745047-157745069 CTTTCTAACTTTAAGGAGGATGG + Intronic
1018215154 6:161519172-161519194 CTTTCCAAGCTGGGGAAGTAGGG + Intronic
1021061570 7:16118915-16118937 CTTACTCAGCTGAGGGAGAAAGG + Intronic
1022682433 7:32562193-32562215 TTTTCTAAGCTGAAGGTTTATGG - Intronic
1022766214 7:33415313-33415335 CTTTCCAAACTCAAGGAATATGG - Intronic
1024036486 7:45511233-45511255 TTTTCTAAGGTGAATGACTATGG + Intergenic
1024991388 7:55237182-55237204 CTTTCTAAGTTGAAAGATTCTGG - Intronic
1025552994 7:62272902-62272924 CTTTCTCTGCTGAAGGCTTAAGG + Intergenic
1036076359 8:5506184-5506206 TTTTCTAAGTTGAAGAAGGATGG - Intergenic
1036402531 8:8423005-8423027 CCTTCTTAGCTGATGGAGCAAGG + Intergenic
1043357378 8:79428896-79428918 CATACTAAGCTGAAGGAACAGGG - Intergenic
1043436797 8:80242991-80243013 ATTTCAAGGCTGTAGGAGTAAGG - Intergenic
1043663400 8:82776117-82776139 ATCTGGAAGCTGAAGGAGTAAGG - Intergenic
1045184166 8:99819103-99819125 ATTTCTAAGCTTAATGAGAAAGG - Intronic
1046613902 8:116455022-116455044 CTTTCTCAGATGAATGTGTATGG - Intergenic
1046933013 8:119859792-119859814 CTTTGTAAGCTAAAGCAGTGTGG + Intergenic
1047523683 8:125615051-125615073 CTCACTCAGCTGAAGGAGCAAGG - Intergenic
1050599386 9:7235166-7235188 CTTTCTGAGCTAAAGGAAAAAGG + Intergenic
1050815402 9:9805681-9805703 CTTTTTAAGCTGAAAAAGTTAGG - Intronic
1051858636 9:21599019-21599041 CTTTCTAAGCTGAAGCTCTGTGG - Intergenic
1052697438 9:31896276-31896298 TGTTCTAAGTTGAAGGACTATGG - Intergenic
1055321906 9:75090419-75090441 CTTTCTGATGTGAAGGAGAAAGG - Intronic
1055487573 9:76772124-76772146 CCTTGTAAGCTGAAGGAAAAGGG + Intronic
1055964419 9:81851580-81851602 CTCACTATGCTGAAGGAGCAGGG + Intergenic
1056144858 9:83719407-83719429 CTTATTAAGGTGAAGGAGTATGG + Intergenic
1056479628 9:86988024-86988046 TTATCTAATATGAAGGAGTAGGG + Intergenic
1057907872 9:98996236-98996258 CTTTCTAAGCTAAAGGGGCTGGG - Intronic
1058088212 9:100774037-100774059 CATTCTGAGATGAAGGAGAAAGG - Intergenic
1059107451 9:111524038-111524060 CATTCTAGACTGAAGGAGCAAGG - Intergenic
1060266319 9:122113514-122113536 CTGTCCATGCTGAAGGAGTAGGG + Intergenic
1061620794 9:131810092-131810114 CTTTCTAAGTTGAATGAGTCAGG + Intergenic
1192928306 X:75779207-75779229 CTTTCTAAGGGGAAAGAGTTAGG - Intergenic
1194685716 X:96911568-96911590 CTTTCCAAGTAGAAGGATTAAGG - Intronic
1194987928 X:100511525-100511547 TCTTCAAAGCTCAAGGAGTAGGG + Intergenic
1195313840 X:103658765-103658787 CTCTCTAAGCTGAAGGAACAGGG - Intergenic
1196294170 X:113979836-113979858 CTTTGTAATCTGGAGAAGTATGG + Intergenic
1197601400 X:128535111-128535133 ATTTCTTAGCTTTAGGAGTAGGG + Intergenic
1198881324 X:141284344-141284366 CTTTCTAATCTTAAGGACAATGG - Intergenic
1201578319 Y:15484361-15484383 CTTTCTCAGTTGCAAGAGTATGG + Intergenic