ID: 924749507

View in Genome Browser
Species Human (GRCh38)
Location 1:246872692-246872714
Sequence AGCACCCATGATAGTGCGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 36}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924749507_924749512 -10 Left 924749507 1:246872692-246872714 CCCATCGCACTATCATGGGTGCT 0: 1
1: 0
2: 0
3: 2
4: 36
Right 924749512 1:246872705-246872727 CATGGGTGCTGAAAGGGAATGGG 0: 1
1: 0
2: 1
3: 16
4: 212
924749507_924749513 -4 Left 924749507 1:246872692-246872714 CCCATCGCACTATCATGGGTGCT 0: 1
1: 0
2: 0
3: 2
4: 36
Right 924749513 1:246872711-246872733 TGCTGAAAGGGAATGGGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924749507 Original CRISPR AGCACCCATGATAGTGCGAT GGG (reversed) Intronic