ID: 924749937

View in Genome Browser
Species Human (GRCh38)
Location 1:246877272-246877294
Sequence TTGAAGCCTGGAATTTTTTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 2, 1: 0, 2: 1, 3: 13, 4: 241}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924749937 Original CRISPR TTGAAGCCTGGAATTTTTTG CGG (reversed) Exonic
901910247 1:12451520-12451542 TTGAAGCCTTAAGTATTTTGTGG + Intronic
903336776 1:22629645-22629667 TGGAAGCCTGGCATAGTTTGAGG + Intergenic
904328997 1:29745709-29745731 TTGAAGTCTGGGATTTACTGAGG + Intergenic
904370814 1:30046359-30046381 TTGAAGGCTGGGATTTACTGAGG + Intergenic
905782298 1:40722617-40722639 ATGAAGCTTGCTATTTTTTGAGG + Intronic
906771174 1:48486122-48486144 TTGAAGCTAGGAAGTTGTTGGGG + Intergenic
907183791 1:52593230-52593252 TTGAGGCCAGGAATATTCTGGGG - Intergenic
908307272 1:62834043-62834065 TTTAAGCCTGGAATATTGTGTGG + Exonic
908704171 1:66932250-66932272 TTGGAGAATGGAATGTTTTGTGG + Intronic
909398490 1:75197746-75197768 TTGAAGCCTGCAGTTTTCAGGGG + Intergenic
909465175 1:75965510-75965532 TTTCTGCCTGGAATTTTGTGAGG - Intergenic
910309458 1:85807160-85807182 TTGAAGCCTGGACTCGATTGTGG + Intronic
910413234 1:86968366-86968388 TTGAAGTCTTGAGTTTTGTGTGG + Intronic
910926298 1:92401299-92401321 TTAATGCCTTGACTTTTTTGTGG + Exonic
913277571 1:117154031-117154053 TTTAAGCCTGGACTTTTTATTGG + Intronic
913526536 1:119699067-119699089 TTAGAGCCTGGAATTTTTGGGGG + Intronic
916440614 1:164821062-164821084 TTGAGACCTTGTATTTTTTGAGG - Intronic
919378334 1:196821378-196821400 TTGAAGCTTGAACTTTTTTTTGG - Intronic
919388028 1:196945415-196945437 TTGAAGCTTGAACTTTTTTTTGG - Intronic
919858176 1:201719824-201719846 TTGAAGTCTGGGATTTTTATTGG - Intronic
920539104 1:206764079-206764101 TTGAAGTGGGGAACTTTTTGAGG - Intergenic
921249729 1:213285715-213285737 TTGAACACAGGAATTTTGTGAGG - Intergenic
922299707 1:224286986-224287008 CTGAAACCTATAATTTTTTGTGG + Intronic
923041113 1:230320399-230320421 GAGAAGCTTGGAAGTTTTTGTGG + Intergenic
924066380 1:240226912-240226934 TTGAAGACTGGATGTTTTTCAGG + Intronic
924749937 1:246877272-246877294 TTGAAGCCTGGAATTTTTTGCGG - Exonic
1066332511 10:34440052-34440074 CTGAAGACGGGAATTTTTTAGGG + Intronic
1067219920 10:44336591-44336613 TTTAACACTGGAATTTTTTCAGG - Intergenic
1070420851 10:76235695-76235717 TAGAAGCTTGGAATTTCTGGGGG + Intronic
1071315790 10:84395799-84395821 GATAAGCCTGGAATATTTTGTGG - Intronic
1074053445 10:109900511-109900533 TTGAAGCCTGGGAGTGTTTGTGG - Intronic
1077748071 11:4931104-4931126 TTGCAAGCTTGAATTTTTTGAGG + Intronic
1078524054 11:12087060-12087082 ATGATGCCTGGAATTGTCTGTGG + Intergenic
1078874842 11:15382840-15382862 TTCAAGCCTGGAAGTCTTGGAGG - Intergenic
1079095390 11:17506639-17506661 AGAAAGCCTGGCATTTTTTGAGG - Intronic
1079127567 11:17729960-17729982 CTGAAGCCTGGAAGTTTTGGGGG - Intergenic
1079471413 11:20781673-20781695 TTTAAGACTTGAATTTTTTTTGG + Intronic
1080289638 11:30656311-30656333 TTGAAGCTTGGGTTTTTTGGAGG + Intergenic
1080959332 11:37140075-37140097 TTGAAGCCTGAAGTTATTTATGG - Intergenic
1082037165 11:47654310-47654332 AAGAAGCCTGGCATGTTTTGAGG + Intergenic
1082094848 11:48121404-48121426 TTCAAGCCTGGGATTTCTGGTGG + Intronic
1083872067 11:65494696-65494718 TTTTAGCCTGGGCTTTTTTGAGG + Intergenic
1085708682 11:78809862-78809884 CTGAAGCATGGCATTTTTGGGGG - Intronic
1086087444 11:82969857-82969879 TTCATGCCTGGAATTTATTCGGG - Intronic
1086139490 11:83479388-83479410 TTGAAAACTAGAATTGTTTGAGG - Intronic
1088588802 11:111383455-111383477 ATGCTGGCTGGAATTTTTTGAGG - Intronic
1089865899 11:121631378-121631400 TTAAAGACTGGAATTTTTTTTGG + Exonic
1089882455 11:121787758-121787780 TTGAAGGCTCTAATTTTTAGAGG - Intergenic
1089909272 11:122079678-122079700 GTGAAGACTTGAATTTTTGGAGG - Intergenic
1090795008 11:130127592-130127614 TTGAGGCCTGGAACCTTCTGAGG + Intronic
1091412127 12:249624-249646 TTTGAGCCTGGAAATTTTTGTGG - Intronic
1092990363 12:13891385-13891407 GTGGAGCCTGTAATTTTTTCAGG - Intronic
1093503605 12:19839023-19839045 CTGAAGCCTGTGATTTCTTGAGG + Intergenic
1093838532 12:23867045-23867067 TTAAAGCTTGAAGTTTTTTGAGG - Intronic
1094165690 12:27440625-27440647 TTAAAGTGTGGAATTTTCTGTGG + Intergenic
1094226647 12:28053704-28053726 TTGAAGCCAGGAACTCTGTGTGG + Intergenic
1094432605 12:30386738-30386760 TTGAACCATGGAATATTTTTAGG - Intergenic
1095285577 12:40406602-40406624 TTATGGCCTGCAATTTTTTGGGG + Intronic
1096733490 12:53633716-53633738 TTGAAGCCAGGACTTTTTGGGGG - Intronic
1099997844 12:89798233-89798255 TTGAATTCTGTAATTTTTGGTGG + Intergenic
1100897196 12:99196948-99196970 TATAAGCCTGGAATTATCTGTGG - Intronic
1101096051 12:101342089-101342111 TTGGAGTTTGGTATTTTTTGGGG + Intronic
1106669069 13:31885797-31885819 TCTAAGCCTGTAACTTTTTGGGG + Intergenic
1106967422 13:35088249-35088271 TTGAAGTATGGAATTATTTAGGG - Intronic
1107461913 13:40612264-40612286 GGGAAGCCTGGATTTTGTTGGGG - Intronic
1110417146 13:75265982-75266004 TTTAAGCCTGAAATTCTTTTAGG + Intergenic
1111026197 13:82528997-82529019 CAGAAGCCTAGCATTTTTTGTGG - Intergenic
1111344875 13:86938660-86938682 ATAAAGCCTATAATTTTTTGAGG + Intergenic
1112075243 13:95906182-95906204 TCGAACACTGGAAATTTTTGTGG - Intronic
1113004898 13:105689629-105689651 TTTAACCCAGGAATTTTTTGAGG - Intergenic
1115901081 14:38148909-38148931 CTAAAGCCAGGAATTCTTTGTGG - Intergenic
1116777249 14:49195110-49195132 TGGAGGCTGGGAATTTTTTGGGG - Intergenic
1117357644 14:54940914-54940936 GTATAGCCTGGATTTTTTTGAGG - Exonic
1119497511 14:75092832-75092854 CTGATGCCTGGTATTTTCTGAGG + Intronic
1119525490 14:75319381-75319403 TTGAAGCATGCAATTTTTTCTGG + Intergenic
1124392116 15:29269097-29269119 CTGAAGCCTGGGACTTTCTGCGG - Exonic
1124470577 15:29981588-29981610 TTGAGGCCTGGAATGGTTTTAGG - Intergenic
1125675551 15:41500678-41500700 TTGGGCCCTGGAATCTTTTGAGG + Intronic
1126606996 15:50488091-50488113 TTGAAGCACAGAAGTTTTTGTGG + Intronic
1127247895 15:57197711-57197733 TTGAAGTCTTGATTTTTTTCTGG + Intronic
1127312912 15:57768183-57768205 ATGAAGCCTGGGATTTTATTAGG + Intronic
1128422421 15:67506286-67506308 TTGCAGCCTGGAGTTTTCTCAGG + Intergenic
1128862547 15:71086104-71086126 TTGAAGCATGGTATTCTTTCTGG + Intergenic
1133835665 16:9365323-9365345 TTGTAGTCTGGATTTTTATGTGG - Intergenic
1134058717 16:11186151-11186173 CTGAGCCCTGGAATTTTTTAAGG + Intergenic
1137315920 16:47323001-47323023 TTGAAGCCTGGCAATTATTTGGG - Intronic
1140878765 16:79178131-79178153 TTCAACGCTTGAATTTTTTGAGG + Intronic
1141014924 16:80439991-80440013 TTGAGCTCTGGAAATTTTTGTGG - Intergenic
1146668267 17:34719484-34719506 TTGAAGCCAGAAATTTTGAGGGG + Intergenic
1147264982 17:39229185-39229207 TTGGAGCCTGGTATTCTGTGGGG + Intergenic
1149905703 17:60525216-60525238 TTAAAGCTTTGATTTTTTTGTGG - Intronic
1151968940 17:77447385-77447407 CTGAAGCTTGGAATGTTTTTTGG - Intronic
1153075328 18:1156115-1156137 CTGAAGCCAGCAATTCTTTGGGG + Intergenic
1155057112 18:22194590-22194612 TTGAAGGGTTGAATTATTTGTGG + Intronic
1155749539 18:29403827-29403849 TGGAACTCTGGAATTTGTTGAGG - Intergenic
1156776605 18:40796870-40796892 TAGAAGCATGGTAATTTTTGGGG - Intergenic
1156817295 18:41326578-41326600 CTGAATACTGGAATTCTTTGTGG + Intergenic
1158848331 18:61468337-61468359 TTGATGTCTTGAATCTTTTGGGG - Intronic
1158903758 18:61990969-61990991 TTGAAGCATTGAAATCTTTGTGG - Intergenic
1159584605 18:70271762-70271784 TTGGAGACTGGAGTTTTTTAAGG - Intergenic
1160105618 18:75972300-75972322 TTGAAACCTCGAACTCTTTGTGG + Intergenic
1162617982 19:11816962-11816984 TTGAAGGCTGGACTTTTATAAGG + Intronic
1166934725 19:46324507-46324529 TTGGAGCCTGGAGTTTAGTGGGG - Intronic
925269571 2:2592617-2592639 TTGCAGTCTGGACTTATTTGTGG - Intergenic
927591541 2:24361305-24361327 TTGAAGTCTGGTCTTTTGTGAGG - Intergenic
928190732 2:29164539-29164561 ATGATACCTGGAATTTTATGAGG - Intronic
930849302 2:55940967-55940989 TTGAAACCAGTAAATTTTTGAGG + Intergenic
931686484 2:64798376-64798398 TGGAATCCTGGAAATATTTGAGG + Intergenic
933949688 2:87317932-87317954 TTGATGTCTGGACTTTTATGAGG - Intergenic
934016527 2:87891575-87891597 TTCAAGCTTGGAATTTCTTAGGG + Intergenic
939322399 2:140641116-140641138 TTTGAGCCTGGCAATTTTTGTGG - Intronic
940020809 2:149154129-149154151 TTGGAACTTGGATTTTTTTGGGG - Intronic
941118832 2:161504989-161505011 TTGAAGCCTGGAATTTTTTGCGG - Intronic
941462933 2:165793512-165793534 TTGCAGCCTAGAACTGTTTGGGG + Intronic
942352867 2:175071727-175071749 TTGAATTCTGGATTGTTTTGAGG + Intergenic
942709835 2:178821157-178821179 TTTAAGCCTGGGACTTTTGGGGG + Intronic
944359602 2:198837663-198837685 TTGGAGCCTCTGATTTTTTGAGG + Intergenic
945099525 2:206251326-206251348 TTTAGTCCTGGAATTCTTTGCGG + Intergenic
945190547 2:207183148-207183170 TAGAAGTCTGGAAGCTTTTGCGG - Intergenic
945452841 2:210013598-210013620 TTAAAGCATGTAATTTTTGGCGG - Intronic
945555537 2:211270885-211270907 TTGGAGACTGGAATTTTTCAAGG - Intergenic
946956706 2:224938524-224938546 TTCAAGATTGGAATTTTTGGAGG - Intronic
947457320 2:230266794-230266816 TTGAAGCCAGCAATCTTGTGTGG + Intronic
947486614 2:230555850-230555872 TTCTAGCCTGGAACTTTTCGAGG - Intergenic
1169434907 20:5577988-5578010 TGGAAGCCTGTCATTTATTGAGG - Intronic
1171338847 20:24411399-24411421 TTGCAGGCTGGTATTTTTTCTGG - Intergenic
1172383316 20:34515006-34515028 TTTAAGGCTGGGAGTTTTTGTGG + Intergenic
1174500018 20:50977470-50977492 GTAAAGCCTGGATTTTATTGTGG - Intergenic
1174526889 20:51179501-51179523 TTTAAGACTGGAATTTTTTGTGG - Intergenic
1174534127 20:51237676-51237698 TTGAAAGCTGGAAACTTTTGTGG + Intergenic
1176901281 21:14445204-14445226 TTGCAGACCAGAATTTTTTGTGG - Intergenic
1177515432 21:22145454-22145476 TTTAACACTGGAGTTTTTTGTGG + Intergenic
1177662856 21:24109825-24109847 TTAAAGCTTGGAATCATTTGGGG + Intergenic
1178201517 21:30412225-30412247 TTGATGCCTAGTTTTTTTTGAGG - Intronic
1183808352 22:40232628-40232650 TCTAACCCTGAAATTTTTTGCGG + Intronic
951087316 3:18528543-18528565 TGGAAGCCTATAATTTTTTAGGG + Intergenic
952037029 3:29215043-29215065 TTGAGGCCTGAAATTTTTCTGGG + Intergenic
952046515 3:29327895-29327917 TAGAATGCTAGAATTTTTTGAGG + Intronic
953373192 3:42407131-42407153 TGGAGGCCTGGATTATTTTGAGG - Exonic
953990317 3:47478258-47478280 TTGGAGCCTCTTATTTTTTGTGG - Intergenic
956506229 3:69943232-69943254 TGGATGCCTTGATTTTTTTGTGG - Intronic
957544697 3:81622567-81622589 TGTAAGCCTGGAATTTAGTGGGG - Intronic
959294174 3:104514119-104514141 TTGAAGACTGGATTTCTCTGGGG + Intergenic
961096250 3:124159097-124159119 AATAAGCCTGGAATTTTTAGGGG - Intronic
962256873 3:133877094-133877116 CTGTGGCCTGGAATTTTCTGAGG - Intronic
965914179 3:173820844-173820866 TTGGAACCTGTAACTTTTTGAGG + Intronic
966770576 3:183500182-183500204 TTAAATCCTGGAATTTTATTTGG + Intronic
967531761 3:190555702-190555724 ATGAAGCTTGCAATTTTTGGAGG - Intronic
967772102 3:193345021-193345043 TTGTAACCTGGACTTTGTTGTGG + Exonic
970181738 4:13404614-13404636 TTGAAGCCTAGAATATTTCTAGG - Intronic
970363844 4:15337931-15337953 TAGTAGCCTCCAATTTTTTGAGG - Intergenic
970799262 4:19952290-19952312 TTGAAGCTAGGGATTTTTTGTGG - Intergenic
973180314 4:47259189-47259211 GTGAAGGCTGGATTTGTTTGTGG - Intronic
973548178 4:52003216-52003238 TTAGAACCTGTAATTTTTTGAGG + Exonic
974552756 4:63400480-63400502 TTGGAGCATTGAATGTTTTGTGG + Intergenic
975023794 4:69523988-69524010 GTGAAGCCTGAAATATGTTGAGG - Intronic
976731687 4:88268292-88268314 TTGTAGCTTGGAATAGTTTGGGG - Exonic
979153394 4:117350004-117350026 TTAAAGCCTGGGATATTTAGTGG - Intergenic
980075795 4:128291443-128291465 TTCCAGCCTGGTATTGTTTGGGG + Intergenic
980386469 4:132092033-132092055 TTCAAGTCTGGAAATTATTGAGG + Intergenic
980651529 4:135722396-135722418 TGGATGCCTTAAATTTTTTGTGG + Intergenic
981534632 4:145786514-145786536 ATCAAGGCTGGAATGTTTTGAGG + Intronic
981689685 4:147493866-147493888 TTGAAGCCTTCAATGTTCTGGGG + Intronic
982237855 4:153268673-153268695 TAGAAGCCAGGAATTCTTTAAGG + Intronic
982933779 4:161443552-161443574 TTGGAGCCTGGAATTGTGTCTGG + Intronic
983403417 4:167294780-167294802 TAGAAACCAGAAATTTTTTGAGG - Intergenic
984729225 4:183051460-183051482 TTGTAGCCTGGATTTTACTGTGG - Intergenic
986168281 5:5294453-5294475 CTGAAGCCCAGACTTTTTTGGGG + Intronic
986300380 5:6473991-6474013 TTGCAGCCAATAATTTTTTGAGG - Intronic
986460191 5:7962414-7962436 TTGAAGCCTCAGATTTTGTGAGG + Intergenic
987076794 5:14390433-14390455 TTGAAGTATGCAATTCTTTGAGG - Intronic
987213360 5:15707559-15707581 TTGAAGCCAGGAACTTTGTGAGG + Intronic
987911693 5:24155098-24155120 TTGAAGCCAGGAAGTTTCAGAGG - Intronic
989217028 5:38915970-38915992 TTAAAGCCTGATATTTCTTGTGG + Intronic
991930950 5:71751860-71751882 TTCAACACAGGAATTTTTTGGGG + Intergenic
992007251 5:72490110-72490132 TTGAAGCCTGGAACTTGTGGAGG - Intronic
992386359 5:76288417-76288439 TTAAGGCCTGGAAGCTTTTGAGG + Intronic
993048977 5:82903187-82903209 TTGAAGAAGGGAATTTTTGGAGG + Intergenic
993050485 5:82920770-82920792 TTGCAGACTGGAATTTCTGGTGG + Intergenic
993819186 5:92592690-92592712 TTGAAGCCTATAATGATTTGAGG - Intergenic
994675833 5:102821138-102821160 TTCAAGCTTGGAATTTTTCAAGG + Intronic
996867364 5:128140704-128140726 TCTATGCCTGAAATTTTTTGGGG - Intronic
997747509 5:136311929-136311951 CTGAAGCCTGGAGATATTTGAGG + Intronic
998611489 5:143694139-143694161 TCCAAGCCTGGAAGTTGTTGAGG + Intergenic
999435839 5:151562644-151562666 CAGAAACCTGGAATGTTTTGTGG + Intronic
1000116403 5:158158002-158158024 TTGCAGCCTGGAATTTCTGCTGG + Intergenic
1000970147 5:167705138-167705160 TAGAAGACTGGAACTTTTTATGG + Intronic
1001215849 5:169855046-169855068 GTGAAGGCTGGAGTTCTTTGAGG - Intronic
1001834187 5:174817129-174817151 TAGAAGCCTGGAAAGTTCTGAGG - Intergenic
1005265779 6:24110918-24110940 CTGGAGCCTGGAATATTATGGGG - Intergenic
1006010588 6:31039850-31039872 TTGAAACGTGGATGTTTTTGAGG - Intergenic
1007328240 6:41080409-41080431 TTTAAGCCCAGAATTTTTTATGG + Intronic
1007567847 6:42866457-42866479 TTGATGCTTGGTATTTGTTGTGG - Exonic
1009234996 6:61112223-61112245 TTGAAGCCTAGAGTTTTATTGGG - Intergenic
1009611654 6:65950573-65950595 TTAAAGTCTGGAATATTTTAGGG - Intergenic
1010960449 6:82139980-82140002 TTGAATCCTGGGCATTTTTGTGG + Intergenic
1014683818 6:124469760-124469782 TTGAAGCCTACACTTTATTGTGG - Intronic
1014970889 6:127813692-127813714 TTGATGCCTGGTACTTTTTGTGG + Exonic
1016251856 6:142052708-142052730 TTGATTGCTGGTATTTTTTGAGG - Intergenic
1016546287 6:145228202-145228224 TTAAAGCCTCAAATTCTTTGTGG + Intergenic
1016608420 6:145961337-145961359 CTGCACCCTGGAATTTTTTAGGG - Intronic
1017102134 6:150858156-150858178 TTGAAGCCTGGTGGTTTATGTGG - Intergenic
1021423696 7:20474340-20474362 TGGAAGACTGGAACTATTTGGGG - Intergenic
1021970558 7:25961504-25961526 TTGTAGCCTGACATTTATTGTGG + Intergenic
1023399756 7:39784003-39784025 TTGAGACCAGGAATTTGTTGTGG - Intergenic
1024677679 7:51652035-51652057 TTGAAACGTGGAATCCTTTGAGG - Intergenic
1026250358 7:68664647-68664669 TTGGAGGCTGGAATTTTTCTGGG - Intergenic
1026865468 7:73821558-73821580 CTGAAGCCTGGAGGTTTTTATGG + Intronic
1028628337 7:92903787-92903809 TTGAAGGTTGGGGTTTTTTGGGG - Intergenic
1030301950 7:107983258-107983280 TTCAAGCTTGGAAGTTTTTTGGG + Intronic
1031007243 7:116487534-116487556 TTTTAGTCTGGCATTTTTTGAGG + Intronic
1031010092 7:116517343-116517365 TTGAAACCTGAAATTTTTCATGG + Intergenic
1032423764 7:131803768-131803790 TTGAAACCTGGATTCTTCTGAGG - Intergenic
1034055897 7:148034707-148034729 TAGAAGCCTGGAAAATTTGGAGG + Intronic
1038103245 8:24404042-24404064 CTGAAGCCTGGAACTGATTGCGG + Exonic
1038670811 8:29581389-29581411 TTGAAGCATGAAAGTTTTGGAGG - Intergenic
1040275540 8:46011914-46011936 TTGAAGCCAGAATTTTCTTGGGG + Intergenic
1041152544 8:54951151-54951173 TGGAAGTTTGGAAGTTTTTGGGG + Intergenic
1041801027 8:61799544-61799566 TTTAAGCCAGGAAGATTTTGAGG - Intergenic
1042762807 8:72289105-72289127 TTGAAAACTGAAATTATTTGGGG - Intergenic
1043750539 8:83928754-83928776 TTGTAGCCTGGGCTTGTTTGGGG + Intergenic
1045042122 8:98235491-98235513 TTGATGCATCAAATTTTTTGTGG + Intronic
1046451743 8:114401448-114401470 TTTAAGCCCAGAATTTTTGGGGG - Intergenic
1046662194 8:116960020-116960042 TTGAAGCCTCGAACTTCTTAAGG + Intronic
1046838045 8:118825081-118825103 AAGAAGCCAGGAATTTTTAGGGG - Intergenic
1047550888 8:125871175-125871197 TTGAACCCTGCATTTTTCTGAGG + Intergenic
1048723175 8:137350937-137350959 TTGAAGCCATAGATTTTTTGGGG + Intergenic
1049962573 9:750684-750706 TGGAAGACTGGATTTTTCTGGGG - Intergenic
1050201529 9:3150134-3150156 CTGCAGCCTGGAAATTTTTAAGG - Intergenic
1050840790 9:10146583-10146605 TTGAAAGCTAGAATTTTCTGAGG + Intronic
1051223755 9:14877472-14877494 TAGGAGACTGGAATTATTTGGGG - Intronic
1051498446 9:17751073-17751095 TTGCAGCCTGAAAATTATTGTGG + Intronic
1054904578 9:70403418-70403440 TTAAAGCCTGGAACTTTTGCTGG + Intronic
1056284184 9:85071246-85071268 TTAGAGCCTGGATATTTTTGGGG - Intergenic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1057502614 9:95607638-95607660 TTCCAGCCTGGGATTTTATGAGG + Intergenic
1058972389 9:110095534-110095556 TTTAACCCTGGAATTTCATGTGG + Intronic
1186166719 X:6834516-6834538 TTCAGGCATGGAATTTCTTGGGG - Intergenic
1186386754 X:9117705-9117727 TTCATGCCTGGGAATTTTTGAGG - Intronic
1186711023 X:12196471-12196493 TTGAAGTTTGGAACTATTTGTGG + Intronic
1186833218 X:13411821-13411843 TTGGAGACTGGGTTTTTTTGAGG - Intergenic
1187146345 X:16640828-16640850 TTGACAACTGGAATTTTCTGAGG + Intronic
1190378300 X:49813058-49813080 TTTCAGCCTGAAATATTTTGGGG - Intergenic
1190648266 X:52543649-52543671 TTGAAGCGTGACATTATTTGCGG + Intergenic
1191052984 X:56214141-56214163 GTGAAGCCTGGAGTTTTTATGGG + Intergenic
1195475118 X:105276613-105276635 CTGAAGTCTGGATTTTTGTGTGG + Intronic
1197221474 X:123918232-123918254 TTGAATACTGGAATTTTGTTTGG + Intergenic
1197227576 X:123969229-123969251 TTGTATTCTTGAATTTTTTGGGG + Intronic
1197965273 X:132054121-132054143 GTAAAGCCTGGAGTCTTTTGTGG + Intergenic
1198382238 X:136094656-136094678 TCAAAGGCTAGAATTTTTTGAGG - Intergenic
1198409081 X:136347617-136347639 TTGGTGACTGGAAATTTTTGTGG - Exonic
1199127959 X:144146965-144146987 TTCAAGCTTGGAATTTCTTAGGG - Intergenic
1199729541 X:150617947-150617969 TTCAAGACTGGAGTTTTTTAAGG - Intronic
1200780449 Y:7210825-7210847 TTGAGGCTTGGAGTGTTTTGGGG - Intergenic
1201166284 Y:11212084-11212106 ATGAAACCTGGAATGTCTTGAGG - Intergenic
1201793945 Y:17874455-17874477 GAAAAGCCTGGAATTTTTGGTGG + Intergenic
1201807609 Y:18031530-18031552 GAAAAGCCTGGAATTTTTGGTGG - Intergenic