ID: 924757318

View in Genome Browser
Species Human (GRCh38)
Location 1:246953141-246953163
Sequence TTCAGGCCTCCTTTGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 293}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924757318 Original CRISPR TTCAGGCCTCCTTTGGAGGG AGG Intronic
900143888 1:1149842-1149864 TGCAGCCCTCCCTTGGAGGAGGG + Intergenic
900549206 1:3245608-3245630 CTCAGGCATCCTGTGGACGGCGG - Intronic
901381928 1:8879761-8879783 CTCAGCCCTCCCTTGGAGTGGGG - Intergenic
901793778 1:11668668-11668690 TCCAGGGCTGCTTTGGAGTGGGG - Exonic
902176244 1:14653126-14653148 GTCATTTCTCCTTTGGAGGGTGG + Intronic
902531448 1:17093450-17093472 CTCAGGCCTCCTGGGGATGGTGG - Intronic
902576581 1:17381753-17381775 TCAGGGCCTCCTTTTGAGGGAGG - Intronic
904493110 1:30872200-30872222 TTCAGGCTTACTGGGGAGGGTGG - Intronic
904503202 1:30929626-30929648 GTGAGGCATCCTTTTGAGGGAGG - Intergenic
904524436 1:31122171-31122193 TGCATGCCTTTTTTGGAGGGGGG - Intergenic
908920607 1:69186662-69186684 TTCAGACCTCCTGGAGAGGGAGG + Intergenic
911702600 1:100971441-100971463 ATCTGACCTCCTTTGGAGGTTGG + Intronic
913794962 1:122597566-122597588 TTGAGGCCTTCTTTGGAGACGGG + Intergenic
913815812 1:122972220-122972242 TTGAGGCCTTCTTTGGAAGCGGG + Intergenic
913819753 1:123042215-123042237 TTGAGGCCTTCTTTGGAAGCGGG + Intergenic
913839575 1:123397203-123397225 TTGAGGCCTTCTTTGGAAGCGGG + Intergenic
913841034 1:123423374-123423396 TTGAGGCCTTCTTTGGAAAGGGG + Intergenic
913863568 1:123828013-123828035 TTGAGGCCTTCTTTGGAAGCGGG + Intergenic
913879275 1:124109393-124109415 TTGAGGCCTCCGTTGGAAGAGGG + Intergenic
915023296 1:152802460-152802482 TTCTGATCTCCTGTGGAGGGAGG - Intronic
917970143 1:180201034-180201056 TTTAGGCCTCGTTTGAAGGAGGG + Exonic
918460198 1:184768415-184768437 TTCAGGAATCTTCTGGAGGGAGG - Intergenic
919572860 1:199270245-199270267 TTAGGGCCTACTTTGAAGGGAGG - Intergenic
919654339 1:200182773-200182795 TTCCGGCTTCCTTTGTAGTGAGG + Intergenic
919824610 1:201494458-201494480 TTCTGGCCTCCTTTGCAGGCTGG + Intronic
920015140 1:202901091-202901113 TTCAGGCACCTTTTGAAGGGTGG + Intronic
920208636 1:204312355-204312377 TTCAGGCCTTCCTGGGATGGAGG + Intronic
924757318 1:246953141-246953163 TTCAGGCCTCCTTTGGAGGGAGG + Intronic
1063386592 10:5619955-5619977 TTCAGCCCTGCTTCGGAGTGGGG + Intergenic
1063694909 10:8325564-8325586 TTTAGGCCTGCTTCCGAGGGTGG - Intergenic
1065954778 10:30684061-30684083 TGCAGGTCTCCTCTGGAAGGGGG - Intergenic
1066825249 10:39563822-39563844 TTGAGGCCTTCTTTGGAAGCGGG + Intergenic
1066827239 10:39611063-39611085 TTGAGGCCTTCTTTGGAAGCGGG + Intergenic
1066828317 10:39687994-39688016 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066828392 10:39689354-39689376 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066828542 10:39692073-39692095 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066828880 10:39698189-39698211 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066829219 10:39704307-39704329 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066829389 10:39707366-39707388 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066829556 10:39710424-39710446 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066829726 10:39713483-39713505 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066829856 10:39715863-39715885 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066829988 10:39718242-39718264 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066830160 10:39721300-39721322 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066830290 10:39723680-39723702 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066830460 10:39726740-39726762 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066830724 10:39731494-39731516 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066830888 10:39734553-39734575 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066831057 10:39737611-39737633 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066831227 10:39740669-39740691 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066831732 10:39749845-39749867 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066831903 10:39752901-39752923 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066832067 10:39755961-39755983 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066832235 10:39759019-39759041 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066832404 10:39762079-39762101 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066832575 10:39765135-39765157 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066832707 10:39767514-39767536 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066832887 10:39770572-39770594 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066833053 10:39773631-39773653 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066833222 10:39776690-39776712 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066833390 10:39779746-39779768 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066833555 10:39782805-39782827 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066833724 10:39785862-39785884 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066833871 10:39788580-39788602 TTGAGGCCTTCTTTGGAAGCGGG + Intergenic
1066833890 10:39788920-39788942 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066834005 10:39790959-39790981 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066834176 10:39794016-39794038 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066834407 10:39798093-39798115 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066834579 10:39801150-39801172 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066834752 10:39804208-39804230 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066835086 10:39810319-39810341 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066835253 10:39813373-39813395 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066835388 10:39815752-39815774 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066835730 10:39821869-39821891 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066836068 10:39827984-39828006 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066836234 10:39831040-39831062 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066836307 10:39832399-39832421 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066836470 10:39835455-39835477 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066836640 10:39838511-39838533 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066836896 10:39842925-39842947 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066837061 10:39845985-39846007 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066837231 10:39849043-39849065 TTCAGGCCTTCTTTGGAAGCGGG + Intergenic
1066837404 10:39852101-39852123 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066837611 10:39855841-39855863 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066837780 10:39858896-39858918 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066837952 10:39861954-39861976 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066838119 10:39865011-39865033 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066838289 10:39868069-39868091 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066838630 10:39874185-39874207 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066838800 10:39877243-39877265 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066838970 10:39880301-39880323 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066839140 10:39883359-39883381 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066839315 10:39886418-39886440 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066839488 10:39889477-39889499 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066839563 10:39890838-39890860 TTCAGGCCTTCTTTGGAAATGGG + Intergenic
1066839901 10:39896948-39896970 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066840067 10:39900005-39900027 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066840147 10:39901366-39901388 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066840241 10:39903065-39903087 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066840411 10:39906122-39906144 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066840769 10:39912582-39912604 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066840939 10:39915643-39915665 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066841107 10:39918699-39918721 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066841200 10:39920398-39920420 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066841275 10:39921758-39921780 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066841443 10:39924814-39924836 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066841619 10:39927871-39927893 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066841786 10:39930929-39930951 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066841955 10:39933986-39934008 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1066843541 10:39965314-39965336 TTGAGGCCTTCTTTGGAAGCGGG + Intergenic
1066890168 10:40888926-40888948 TTGAGGCCTTCTTTGGAAGCGGG + Intergenic
1066926267 10:41695851-41695873 TTCAGGCCTTCTTTGGAAAAGGG + Intergenic
1066926439 10:41698909-41698931 TTCAGGCCTTCTTTGGAAAAGGG + Intergenic
1066926609 10:41701967-41701989 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1067139848 10:43648247-43648269 ATCCGGCGTCCTCTGGAGGGCGG + Intronic
1068161434 10:53270280-53270302 TTCAGGCTTCCACTGGGGGGGGG - Intergenic
1068419526 10:56771916-56771938 TTCAGGACACCATGGGAGGGTGG - Intergenic
1070412005 10:76150358-76150380 TTCAGGCCCCCTTTGTGAGGTGG - Intronic
1070806749 10:79275281-79275303 TACTGTCCTCCTTTTGAGGGTGG + Intronic
1070982300 10:80659434-80659456 TCCAGGCAGCCTGTGGAGGGAGG - Intergenic
1071729323 10:88232268-88232290 CTCAGACCTTCTTTGGAGGGTGG - Intergenic
1071793397 10:88980300-88980322 TTCAGGCCTTCTTTGAAGCTAGG + Intronic
1072363835 10:94688590-94688612 GTCAGTCCTCATATGGAGGGTGG + Intronic
1072453235 10:95555765-95555787 TTCTGCCCACCTTGGGAGGGTGG - Intronic
1072631973 10:97152411-97152433 ATCAGGGCTACTTCGGAGGGTGG - Intronic
1078931373 11:15914324-15914346 TGCTGGCTTCCTTTGGAGTGGGG + Intergenic
1080369066 11:31613028-31613050 TTCCGTCGTGCTTTGGAGGGTGG + Intronic
1082164897 11:48935721-48935743 TTGAGGCCTTCTTTGGAAGAGGG - Intergenic
1082768993 11:57191212-57191234 TTCATGGCTCCTTTCGAGGAGGG + Exonic
1083316169 11:61816181-61816203 TGCAGGCCGCCTGGGGAGGGAGG - Intronic
1084767737 11:71323523-71323545 TTCAGGCCTCCTGTGGCAGCCGG - Intergenic
1085091279 11:73716427-73716449 TCCAGGGCTTTTTTGGAGGGAGG - Intronic
1085353285 11:75814747-75814769 AACAGGCCTCCGGTGGAGGGCGG - Intergenic
1087453081 11:98349874-98349896 TTTAGGTTTCTTTTGGAGGGAGG + Intergenic
1090453360 11:126826071-126826093 TTCAAGCCTTCTTTGGAAAGGGG - Intronic
1090699930 11:129284918-129284940 TTCAGGCCAAGCTTGGAGGGAGG - Intergenic
1090703595 11:129316780-129316802 CTGAGGCCACGTTTGGAGGGTGG + Intergenic
1094954867 12:35988774-35988796 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1094961664 12:36098834-36098856 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1095014545 12:36954265-36954287 TTCAGGCCTTCTTTGGAAACGGG + Intergenic
1095030145 12:37262968-37262990 TTCAGGCCTTCTTTGGAAATGGG - Intergenic
1096145654 12:49276965-49276987 TTCAGGCCTCTGCTGGAAGGTGG + Intergenic
1096493646 12:52026794-52026816 TGCAGGCCTAGTTTGGTGGGTGG - Intronic
1103476422 12:121222175-121222197 TTGTGGCCTCCTGGGGAGGGCGG + Intronic
1104013327 12:124947270-124947292 TCCATGCCTTCTTGGGAGGGTGG - Exonic
1104059034 12:125252390-125252412 TGCAGGCCTCCGTGGGAGGCTGG - Intronic
1106121718 13:26865161-26865183 TTCTGGGCCCCTTTGGAGGTAGG + Intergenic
1109651807 13:65336876-65336898 CTCAGGCCTCTCTTGGGGGGAGG - Intergenic
1110300652 13:73922888-73922910 CCCAGGCCTCCTCTGTAGGGTGG + Intronic
1111899830 13:94187184-94187206 TCCAAGCCTTCTTTTGAGGGAGG - Intronic
1114000525 14:18237376-18237398 TTGAGGCCTTCTTTGGAAGCGGG - Intergenic
1114430837 14:22659017-22659039 TGGAGGCCACCTATGGAGGGTGG - Intergenic
1115640603 14:35333448-35333470 TCCAGGCCTACCTTGAAGGGAGG + Intergenic
1117338204 14:54772877-54772899 ATGAGACCTCCTTTGGAGGAAGG - Intronic
1118383685 14:65238148-65238170 TTCTGGCCTCCCTTGTAGGGAGG + Intergenic
1119468255 14:74876549-74876571 TTCAGGCCTCTGTGGGAGGGAGG - Intergenic
1121338684 14:93092462-93092484 GTCAGGCCTGCTTTGGGGGCTGG - Intronic
1122421228 14:101578807-101578829 ATCAGGCCTTCTTTGGAGTGTGG - Intergenic
1124142012 15:27085716-27085738 CACAGGCCTGCATTGGAGGGAGG + Intronic
1124840931 15:33241460-33241482 TCCAGGCGGCCTTTGAAGGGCGG - Intergenic
1126878907 15:53073350-53073372 TTCAGCCAGACTTTGGAGGGAGG + Intergenic
1127810436 15:62560738-62560760 CTCAGCCCTTCTTTGCAGGGTGG + Intronic
1128081145 15:64857620-64857642 TACAGGGTTCCTTAGGAGGGTGG + Intronic
1128775108 15:70314201-70314223 CTCACGCCTCCTTTGGAGTCAGG + Intergenic
1129696659 15:77744088-77744110 TCCAGGCCTCGTTTGGGGAGAGG - Intronic
1130866071 15:87934234-87934256 TTCTGGCCTCATAGGGAGGGTGG - Intronic
1132906855 16:2286922-2286944 TTCAGGGCTTCTGTGGAGGGGGG - Exonic
1133398133 16:5464680-5464702 TTCAGCCCAGCTGTGGAGGGTGG + Intergenic
1135549408 16:23386703-23386725 TTCCCGCCTCCTTTGTAGCGGGG + Intergenic
1136340789 16:29641811-29641833 GTCAGTCCTCCAATGGAGGGAGG + Intergenic
1139420863 16:66848810-66848832 GTGAGGCATGCTTTGGAGGGTGG + Intronic
1141592137 16:85076500-85076522 TTCAGGCCACCATAGGTGGGAGG + Intronic
1144060571 17:11580449-11580471 TTCAGGCTTTCTCTGGAGGAAGG + Intergenic
1144820358 17:18068912-18068934 TTCAAGCCTCCTAGGGAGGTGGG - Intergenic
1144825370 17:18102794-18102816 TCCTGCCCTCCTTTGCAGGGTGG + Intronic
1146108990 17:30069949-30069971 TTGAGGCCGCCTTGGCAGGGGGG + Intronic
1146322286 17:31856488-31856510 TTCAGGCATCCATTGGGGCGGGG + Intronic
1146550767 17:33778599-33778621 ATCAGGCCGCCTGTTGAGGGAGG - Intronic
1148092735 17:45032383-45032405 GTCATCCCTCTTTTGGAGGGAGG + Intronic
1150158813 17:62876426-62876448 TCCAGGGCTCCTTTTGAGGTGGG - Intergenic
1150432483 17:65129392-65129414 TTTAAGCATCCTTTGCAGGGTGG + Intergenic
1151232652 17:72695805-72695827 TGCAGGCATCCTTTGGCTGGTGG - Intronic
1151256032 17:72877390-72877412 TTCCTGACTCCTTTGAAGGGTGG + Intronic
1151920013 17:77147539-77147561 CTCAACCCTCCCTTGGAGGGCGG + Intronic
1151945249 17:77316135-77316157 TTCAGTGTTCCTCTGGAGGGAGG + Intronic
1155025183 18:21934619-21934641 TTGAGGCCTTCTCTGGAGAGAGG + Intergenic
1155196123 18:23476499-23476521 TTCTGGCCTCTTTGGGAGGTGGG + Intronic
1157272374 18:46286021-46286043 GTCAGGCTGCCTTGGGAGGGAGG + Intergenic
1160983666 19:1827806-1827828 TCCAGGCCCTCTTTGGAGGGTGG + Exonic
1162634396 19:11955752-11955774 ATCAGTCCTCCTTTGCAGGTTGG + Intronic
1163510613 19:17733078-17733100 TTCAGGCCTCCTGCTGAGGAGGG + Intronic
1163725740 19:18922189-18922211 GGCAGGCCTCCCTTGGAAGGAGG + Intronic
1164601276 19:29565252-29565274 TCCTGGCCTCCTGTGGCGGGTGG + Intergenic
1165899993 19:39164908-39164930 CTCAGGCCACATTTGGTGGGAGG + Intronic
1167270385 19:48502571-48502593 TTCAGGTCCCCCTGGGAGGGAGG + Exonic
1168186836 19:54705532-54705554 GTCAGAGCTCCTGTGGAGGGAGG + Intergenic
926083632 2:10007703-10007725 TGCAGGCAACTTTTGGAGGGTGG + Intergenic
926677164 2:15635374-15635396 TAGAGGATTCCTTTGGAGGGAGG + Intergenic
927852715 2:26510371-26510393 TTCGGGCTTCCCTGGGAGGGAGG - Intronic
928173985 2:29021963-29021985 TTCATGGCTCCTGGGGAGGGAGG + Intronic
930308772 2:49711656-49711678 TTTCAGCCTCCTTTGGAGGTAGG + Intergenic
930802483 2:55457298-55457320 CACCTGCCTCCTTTGGAGGGTGG - Intergenic
930841873 2:55856320-55856342 TGCAAACATCCTTTGGAGGGAGG - Intergenic
933798466 2:85940782-85940804 ATCAGGGCTCCTTTGATGGGCGG + Intergenic
933892422 2:86783990-86784012 TTGAGGCCTCCTGTGGAAGCAGG - Intergenic
935331635 2:101981610-101981632 CTCAGGCTTCCTGTGCAGGGTGG - Intergenic
939177335 2:138764239-138764261 TTCATGATTCTTTTGGAGGGTGG - Intronic
941704062 2:168639209-168639231 TACAGGCTTCCTTTGGCCGGAGG + Intronic
942928231 2:181457939-181457961 CTCCTGCCTCCTTGGGAGGGAGG - Intronic
943398692 2:187375690-187375712 TTCTGGCCTCTTTTGGAATGAGG + Intronic
947003003 2:225478753-225478775 TTCAGGACCCTGTTGGAGGGTGG + Intronic
1169195281 20:3679452-3679474 TTCAGGGCCCCTGTGGAGGGCGG + Intronic
1169221439 20:3825463-3825485 TAGAGGCCTCCTTTGGATGGTGG + Exonic
1171995100 20:31724731-31724753 TTTAGTCTTTCTTTGGAGGGTGG + Intergenic
1174425155 20:50427098-50427120 TTCCAGCCTCCTTTGCAGCGTGG - Intergenic
1180425039 22:15168175-15168197 TTGAGGCCTTCTTTGGAAGCGGG - Intergenic
1181776954 22:25166601-25166623 TTCAGGCCCTCTTTGGAGTCAGG - Intronic
1182158793 22:28101328-28101350 TTCAGGACTCCTTAGGATAGTGG - Intronic
1182561284 22:31161246-31161268 TCCGTGCCTCCTTTCGAGGGAGG + Intronic
1183740121 22:39664559-39664581 TTCAGGCCGCCCTCTGAGGGCGG - Intronic
1184644690 22:45889550-45889572 CTCAGGCCTCCTCTGGGGGTTGG + Intergenic
1184718171 22:46293806-46293828 TTCAGCCCTCCTGTGAGGGGCGG + Exonic
1185092588 22:48784372-48784394 TCCTGGCCTCCTTTGGGGCGTGG + Intronic
950488749 3:13289462-13289484 TACAGGGCTCCTGTGGCGGGGGG - Intergenic
952863575 3:37835154-37835176 TTCAGGCATCCACTGGTGGGGGG + Intergenic
954642587 3:52110317-52110339 TGCAGGCTTCCTTGGGAGGCTGG - Intronic
956069082 3:65428851-65428873 TTCAGGTCTCCTTATGAGAGAGG - Intronic
957542367 3:81588981-81589003 TTCAGCCCTCCTTTTGAAGGTGG + Intronic
958218590 3:90627677-90627699 TTGAGGCCTTCTTTGGATGCGGG - Intergenic
958220508 3:90668274-90668296 TTGAGGCCTTCTTTGGAAAGGGG - Intergenic
961545942 3:127633272-127633294 TTCACGTATCCTTTGGAGGAAGG + Intronic
961933738 3:130561304-130561326 TTCAGGCTTCTTTGGGAGGAAGG + Intronic
962233477 3:133687182-133687204 TTGAGGCCTGTTTTGGAGTGGGG + Intergenic
970309496 4:14767197-14767219 TTCAGGACTCATTTGGAAGTTGG + Intergenic
975318680 4:72984517-72984539 TTCAGGGCTCCAGTGGAGGCTGG - Intergenic
976177737 4:82372453-82372475 TACAGGCCTCCCTTAGTGGGCGG + Intronic
978017456 4:103762993-103763015 TTGAGGCCTCCTTTGAGGGAAGG + Intergenic
978104529 4:104885028-104885050 TTGAGGTCTCCTCTGGAGAGTGG - Intergenic
979675245 4:123402411-123402433 TTCAGGCATCCTTTAGCAGGAGG - Exonic
980281349 4:130725165-130725187 TTCAGGACTCCATTGGGGAGTGG - Intergenic
982147673 4:152414959-152414981 TTCAGGCCTACCTTGGGGGAGGG + Intronic
982791564 4:159597934-159597956 TTTTGGCCTCCCTTGGCGGGGGG - Intergenic
983484744 4:168320141-168320163 TTTTGGCCTCTTTTGGAGGGAGG - Intergenic
983579576 4:169293917-169293939 TTCAGTCCACCTGTGCAGGGTGG + Intergenic
984382721 4:179015766-179015788 TCCAGGCCTCGTTTAGAGGCTGG - Intergenic
985481620 5:114874-114896 TTCAAGCCTCCCATGGAGGAAGG - Intergenic
986271715 5:6236961-6236983 TTCAGGTCTCTTCTGGAGTGTGG - Intergenic
986443840 5:7804016-7804038 CTTAGGCCTCCCATGGAGGGGGG + Intronic
986514916 5:8551265-8551287 TTCTGGCCTCCTTGGAAGAGTGG - Intergenic
989932069 5:49967242-49967264 TTCAGGCCTTCTTTGGAAACCGG + Intergenic
995435392 5:112129274-112129296 TTCAGGCAACCTGAGGAGGGTGG - Intergenic
998046733 5:138993078-138993100 TCTCGGCCTCCTTTGCAGGGAGG + Intronic
998648901 5:144095155-144095177 TTCAGGAGTCCTGTGGAGGTGGG + Intergenic
998651247 5:144124135-144124157 TGCATTCCTCCTTTAGAGGGTGG + Intergenic
999166282 5:149551759-149551781 TTAAGGCCTCCTTAGGAGTTGGG + Intergenic
999302320 5:150498858-150498880 TTCATGCCTCCTTTTTGGGGAGG + Intronic
1202774403 5_GL000208v1_random:53149-53171 TTCAGGCCTCCGTTGGAAACGGG - Intergenic
1006378238 6:33683587-33683609 TCCAGGCTTCCTCTGGAAGGAGG - Intronic
1006929924 6:37681333-37681355 TTCAGGTCTCCTAGGAAGGGTGG + Intronic
1006942679 6:37763336-37763358 TTTTGGCCTGCTTTGGAGTGTGG + Intergenic
1009150276 6:59736219-59736241 TTCAGGCCTTCGTTGGAAAGGGG + Intergenic
1010806786 6:80246522-80246544 TCCAGACCTCCTTTGGTGGGAGG + Intronic
1012893077 6:104919191-104919213 TTCTGCCCTCATTTTGAGGGGGG - Intergenic
1012996699 6:105981982-105982004 TTCAGTCTTCCTTGGGAAGGTGG - Intergenic
1013465271 6:110412511-110412533 TTCTGGCCTCCTGCTGAGGGTGG + Intronic
1013987737 6:116216023-116216045 TTCATTCCTCCTTTGAAAGGAGG - Intronic
1019564700 7:1673559-1673581 TTCCAGCCTCCTGGGGAGGGAGG + Intergenic
1019842032 7:3456877-3456899 TTCTGGCCTGCTTTTGTGGGTGG + Intronic
1021135667 7:16962219-16962241 TTTAGGCCTCCATTGGATGAAGG - Intergenic
1022311843 7:29203987-29204009 TGCAGGCTTTCTTTGGAAGGAGG - Intronic
1023802109 7:43844060-43844082 TTCAGGCCTACTTTGGTGACTGG - Intergenic
1023921490 7:44633553-44633575 TCCAAGACTCCCTTGGAGGGAGG + Intronic
1024858037 7:53804536-53804558 TCCAGGCCTCATTTAGAGAGGGG + Intergenic
1025142131 7:56475190-56475212 CTCAGGCCTGCTTCTGAGGGTGG + Intergenic
1025455984 7:60527346-60527368 TTGAGGCCTCCTTTGGAAACGGG + Intergenic
1025569220 7:62536157-62536179 TTGAGGCCTTCTTTGGAAAGGGG + Intergenic
1025569229 7:62536328-62536350 TTGAGGCCTTCTTTGGAAAGGGG + Intergenic
1025708278 7:63886618-63886640 CTCAGGCCTGCTTCTGAGGGTGG + Intergenic
1028441486 7:90867660-90867682 TTCAGGTTTTTTTTGGAGGGGGG + Intronic
1030094484 7:105885799-105885821 TCCAGGTCTCCTTTGGTGGGAGG + Intronic
1031376309 7:121030793-121030815 TTCAGGCATCCACTTGAGGGGGG + Intronic
1032546769 7:132750496-132750518 TGCAGGTCTCCTGTGCAGGGCGG - Intergenic
1032643713 7:133797704-133797726 TTCAGGAATCCTATGGAGGAGGG - Intronic
1034568183 7:151932587-151932609 TTCTGGCCACCTTTGGAGACTGG - Intergenic
1035566459 8:644260-644282 TTCAGGGCTCCTGCAGAGGGTGG + Intronic
1036582042 8:10084184-10084206 TTCTGGCCTCCTGAGGATGGTGG + Intronic
1037655114 8:20876348-20876370 TGCAGTCCTGCTTTGGAGGCAGG + Intergenic
1038628429 8:29217171-29217193 TGCAGGCCTCCTCTACAGGGTGG - Intronic
1040142828 8:43945712-43945734 TTGAGGCCTTCTTTGGAAAGGGG + Intergenic
1040271492 8:45951909-45951931 TTCAGGCCTTCTTTGGAAAGGGG + Intergenic
1041863301 8:62538507-62538529 TTAAGGTTTACTTTGGAGGGGGG - Intronic
1045330034 8:101147691-101147713 CTCAGCCCACCTTTGGAGGCTGG + Intergenic
1049328222 8:142035056-142035078 ACCAGGCCTCCCTTGGAGGGTGG + Intergenic
1049781363 8:144430429-144430451 TTGGGGCCGCTTTTGGAGGGTGG + Exonic
1050290019 9:4144199-4144221 TTCTTTCCTCCTTTGGACGGAGG - Intronic
1050722052 9:8601321-8601343 TCCAGGCCTTCTTTTAAGGGTGG - Intronic
1050821945 9:9890014-9890036 TCCATGCCTCTTTGGGAGGGTGG - Intronic
1053712445 9:40832259-40832281 TTAAGGCCTTCTTTGGAAAGGGG + Intergenic
1054422982 9:64965507-64965529 TTAAGGCCTTCTTTGGAAAGGGG + Intergenic
1055459360 9:76503352-76503374 TTCAGGAATCCTTTGGATGGTGG - Exonic
1056288396 9:85114541-85114563 TTCAGGTCTCCTTTTGAGAGTGG - Intergenic
1057214425 9:93220123-93220145 GCCAGGCCTCCTCTGGAGGCAGG + Intronic
1059135874 9:111805662-111805684 CTCAGGCCTCCTTTAGAGCAGGG + Intergenic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1203340512 Un_KI270311v1:360-382 TTGAGGCCTTCTTTGGAAAGGGG + Intergenic
1203418166 Un_KI270366v1:3911-3933 TTCAGGCCTCCGTTGGAAACGGG - Intergenic
1188308148 X:28584526-28584548 TTCCACCCTCCTTTGGAGGGAGG + Intergenic
1190427452 X:50346295-50346317 CTAAGGCCTTCTCTGGAGGGAGG - Intronic
1190847839 X:54210792-54210814 TTTAGGATTCCTTTTGAGGGAGG - Intronic
1192487961 X:71547151-71547173 TTCAGTCCTCCTTGGGAGACGGG + Intronic
1195381720 X:104277489-104277511 TTCAGGACTCTTCAGGAGGGAGG + Intergenic
1197235688 X:124060089-124060111 TTCCCGACTCCTTTGGCGGGGGG - Intronic
1198428690 X:136544799-136544821 TTCAGGGCTGGTTTGGAGGCTGG - Intronic