ID: 924759261

View in Genome Browser
Species Human (GRCh38)
Location 1:246968856-246968878
Sequence CAGCTAAAGCACAGGGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 337}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924759257_924759261 -5 Left 924759257 1:246968838-246968860 CCATGGCTGGAGCTGGAGCAGCT 0: 51
1: 168
2: 359
3: 581
4: 1075
Right 924759261 1:246968856-246968878 CAGCTAAAGCACAGGGAACAGGG 0: 1
1: 0
2: 1
3: 36
4: 337
924759255_924759261 3 Left 924759255 1:246968830-246968852 CCTTTTAGCCATGGCTGGAGCTG 0: 169
1: 413
2: 972
3: 1366
4: 1471
Right 924759261 1:246968856-246968878 CAGCTAAAGCACAGGGAACAGGG 0: 1
1: 0
2: 1
3: 36
4: 337
924759252_924759261 22 Left 924759252 1:246968811-246968833 CCTGAAACATATCTGGAGTCCTT 0: 1
1: 0
2: 6
3: 41
4: 256
Right 924759261 1:246968856-246968878 CAGCTAAAGCACAGGGAACAGGG 0: 1
1: 0
2: 1
3: 36
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924759261 Original CRISPR CAGCTAAAGCACAGGGAACA GGG Intronic
900294578 1:1942557-1942579 CAGCTCAAGCACAGGGCACGTGG + Intronic
900748357 1:4376958-4376980 CAGCTGAACCTCAGGGCACATGG - Intergenic
900831222 1:4967131-4967153 CAGCTGGAGCAGAGGGAGCAGGG - Intergenic
901422023 1:9157521-9157543 CACCTAATGCACAGCGGACACGG + Intergenic
903517529 1:23921909-23921931 AGGTTAAAGCAGAGGGAACATGG - Intergenic
904835412 1:33332402-33332424 CACCTAGAGGACAGGTAACACGG + Exonic
904876901 1:33662347-33662369 TGGCTGAAGCACAGGGAGCAAGG - Intronic
904979777 1:34489188-34489210 CAGCTAAAGCAGTGTTAACAGGG + Intergenic
905534581 1:38710462-38710484 CAGCTAAAGACAAGGGTACAAGG + Intergenic
906014257 1:42560131-42560153 CAGCTAAAGCAGTGGTAAGAGGG + Intronic
906792224 1:48669044-48669066 CAGAAGAAACACAGGGAACACGG - Intronic
907393671 1:54175020-54175042 CAGCAGAGGCACAGGGAAGAGGG + Intronic
907910324 1:58820135-58820157 CAGCTGAAGCTTGGGGAACAGGG - Intergenic
908283502 1:62568240-62568262 CAGCTAAAGCAGTGTTAACAGGG + Intronic
908342197 1:63193085-63193107 TAGCTGGAGCACAGTGAACAAGG + Intergenic
908888395 1:68816146-68816168 CAGCAAAGGAAAAGGGAACATGG - Intergenic
909903978 1:81174246-81174268 CAGCTCAGGCCCAGGGAGCAGGG + Intergenic
909987934 1:82185376-82185398 AAGCTGTACCACAGGGAACAAGG + Intergenic
910064607 1:83138495-83138517 CAGCTAAAGCAGTGGTAAGAGGG - Intergenic
910505423 1:87945285-87945307 CATGTAAAGCACTGAGAACAGGG - Intergenic
910747099 1:90585915-90585937 GAATTAAAGCACAGTGAACAAGG + Intergenic
910748331 1:90598838-90598860 CAGCTAAAGCAGTGTGTACAGGG + Intergenic
910859057 1:91725561-91725583 CACCTAAAGCACTGGACACAGGG - Intronic
912491767 1:110066365-110066387 CAGCTACAGCCCAGGGACCAGGG + Intronic
913115420 1:115692201-115692223 CAGGTAAAGCACAGGGAGAGAGG + Exonic
914388715 1:147198452-147198474 AAGCAAAAGCACAGGGTACAAGG + Intronic
915062619 1:153198783-153198805 GACCTAAAGCTCAGGGAAGAGGG + Intergenic
915639533 1:157213244-157213266 CAGCTAAAGCAGAGTTAAGAGGG - Intergenic
917290148 1:173463716-173463738 CAGCTAAAGCACTGTTAAGAGGG + Intergenic
917305543 1:173620442-173620464 CAGCTAAAGCAGAGTTAAGAGGG + Intronic
917693055 1:177488794-177488816 TGGCTAAAGCCCAGGGTACATGG + Intergenic
918092072 1:181305681-181305703 CTACAAAAGCACAGGGAAAAGGG + Intergenic
919684647 1:200472378-200472400 CAGGTAAAGCACATGGAACCAGG + Intergenic
920209310 1:204316466-204316488 CTGCAAAGGCACTGGGAACAAGG - Intronic
920452467 1:206070130-206070152 TAGCTAAAGCCCAGGGGTCAAGG + Intronic
920652913 1:207852084-207852106 CATGTAAAGCACACAGAACATGG + Intergenic
920921647 1:210302486-210302508 CAGCTAGAGCACTAAGAACATGG + Intergenic
922307147 1:224353871-224353893 TGGCTAAAGCACAGGGGAAAAGG - Intergenic
922742775 1:228023863-228023885 TAGCTAAATCACAGGGGAGAAGG - Intronic
922806194 1:228391318-228391340 CAGGGAAAGCACAGGGATCCGGG + Intergenic
923154336 1:231264125-231264147 TACCAAAAGCACAGGGAACCAGG - Intronic
924271028 1:242332924-242332946 CAGGTACCTCACAGGGAACAAGG + Intronic
924759261 1:246968856-246968878 CAGCTAAAGCACAGGGAACAGGG + Intronic
1064873970 10:19971934-19971956 CGGCTAAAGCACAGGGCAGATGG + Intronic
1065246266 10:23761406-23761428 CAGCTAAAGCACTGTTAAGAGGG - Intronic
1066550525 10:36551676-36551698 CAGGCAAAGCACAGGGACCTTGG + Intergenic
1067786826 10:49256351-49256373 CAGCTAATGCAGAATGAACAAGG + Intergenic
1068687421 10:59883285-59883307 AAGCTATGGGACAGGGAACAAGG + Intronic
1069052991 10:63813953-63813975 CAGCTAAAGCACTGTTAAAAGGG - Intergenic
1069629528 10:69889277-69889299 CAGATGGAGCACAGGGGACAGGG + Intronic
1070321495 10:75358140-75358162 CAGCAAAAGCTTAGGGAACCAGG - Intergenic
1070505604 10:77110341-77110363 CACCTAAAGCAAATGGGACAGGG + Exonic
1070963089 10:80512580-80512602 CAGAAAAAGGACAGGGAAGAGGG - Intronic
1071317173 10:84413300-84413322 CAGCTAAAGCACTGTTAAGAGGG - Intronic
1073848545 10:107587596-107587618 CAGCCAAACCACATGGAAGATGG - Intergenic
1075020526 10:118948823-118948845 CAGCCAAAGAACAGGGCCCAGGG + Intergenic
1075021199 10:118953774-118953796 CAGTTAAGGGACAGGGATCAGGG - Intergenic
1076591771 10:131588466-131588488 CAGAGAGAGCCCAGGGAACAGGG + Intergenic
1076595328 10:131621603-131621625 CAGCTGAAGCCCAGGAGACAGGG - Intergenic
1078012103 11:7580315-7580337 CAGCTGAAGCACAGGAGAAAGGG - Intronic
1078707411 11:13758543-13758565 CAGCTAGATCAGAGGGAAGATGG - Intergenic
1078762710 11:14264151-14264173 CAGATGAAGCACAGAGGACAAGG + Intronic
1079265170 11:18924179-18924201 CAGCTAAAGCACTGTTAAGAGGG + Intergenic
1081046556 11:38280862-38280884 CAGCTAAGGCACTGTTAACAGGG - Intergenic
1081454671 11:43209853-43209875 CAGCTAAAGCAGTGGTAAGACGG - Intergenic
1082129790 11:48474135-48474157 CAGCTGGATCACAGTGAACAAGG - Intergenic
1082806493 11:57454925-57454947 CCTCTAAAGCACAGGGCTCAGGG + Intergenic
1082903330 11:58280475-58280497 CAGCTAAAGCAATGGTTACAGGG - Intergenic
1083284249 11:61647767-61647789 CAGCAAAAGCATAAGGAACCAGG - Intergenic
1083424958 11:62578768-62578790 CTGCTAGAGGACAGGGAAGAGGG - Exonic
1083949849 11:65947862-65947884 AAGCTACACCGCAGGGAACAGGG + Intronic
1084323918 11:68388249-68388271 CAGCTACAGTGAAGGGAACACGG + Intronic
1085568964 11:77542628-77542650 TAGCTAAAACAAAGGGAAAATGG + Intronic
1087092529 11:94288504-94288526 CAACTAAACCACCAGGAACATGG - Intergenic
1087107102 11:94421685-94421707 CAGCTTAAATACAGGGAACATGG + Intronic
1087316733 11:96612265-96612287 CAGCTAAAGCACTGTTAAAAGGG - Intergenic
1087391435 11:97540059-97540081 CAGCTAAAGCACCGTTAAGAGGG + Intergenic
1088928015 11:114321753-114321775 CTGATAAAGCAGAGAGAACATGG - Intergenic
1089596253 11:119582630-119582652 CAGGAAAAGCACAGTAAACAAGG + Intergenic
1089749862 11:120643362-120643384 CAGCTCAAGCACAGGCCCCAAGG + Intronic
1090954239 11:131500378-131500400 AAAATAAAGCACAGGGAACAGGG - Intronic
1092444811 12:8544794-8544816 CAACTAAAGAACAGGGTCCAGGG - Intergenic
1092791976 12:12078289-12078311 AAGCTAAAGCAGAGGGTAGAGGG + Intronic
1093383061 12:18518884-18518906 CAGCTAAAGCAGTGTTAACAGGG - Intronic
1093899201 12:24610611-24610633 CTTCAAAAGCACAGGAAACAAGG - Intergenic
1095230078 12:39729310-39729332 CAGCTAAAGCAGTGGTTACAGGG - Intronic
1097263773 12:57734462-57734484 TAGCAAAAGCACTGGGAGCATGG - Intronic
1097498743 12:60376282-60376304 CAGCTAAAGCAGTGTTAACAGGG + Intergenic
1098911906 12:76217704-76217726 CAGGAAAAGCACAGTAAACAAGG - Intergenic
1099124823 12:78740334-78740356 GAGCCATAGCACAGGGAAAAAGG + Intergenic
1099302578 12:80916399-80916421 GAGCTGGAGCAGAGGGAACAAGG - Intronic
1103233779 12:119354605-119354627 CAGCTACAGCACAGTGCACGGGG + Intronic
1104038041 12:125112087-125112109 CACTTAAAGGACAGGGAACTCGG - Intronic
1104220712 12:126782272-126782294 CTGCCAAAGCACAGCGAAGAAGG - Intergenic
1105074492 12:133263730-133263752 CAGCAAAAGCACAGTAGACAAGG + Intergenic
1106756511 13:32827635-32827657 TAGCTATGGCACAGGGAACTGGG + Intergenic
1107362767 13:39637858-39637880 TTGCAAGAGCACAGGGAACAAGG - Intergenic
1107435223 13:40375816-40375838 CAGCCAAGCCACAGTGAACATGG - Intergenic
1107760667 13:43674973-43674995 TGGCTAAAGCACAGTGAACAAGG + Intronic
1107773436 13:43812462-43812484 CACATAAAGCACAGGGAAGAAGG - Intergenic
1108073824 13:46658359-46658381 CAGCTAAAGCACTATGGACAGGG - Intronic
1108160692 13:47635297-47635319 CAGCTAAAGCAGAGTTAAGAGGG + Intergenic
1108472936 13:50785673-50785695 CAGCTACAGCCCAGAGAAGAAGG - Intronic
1109307658 13:60658943-60658965 CAGCTAAAGCAGTGTTAACAGGG - Intergenic
1109469805 13:62790402-62790424 CAGCTATGTCACAGTGAACAGGG - Intergenic
1109569046 13:64162188-64162210 CAGCTAAAGCAGTGTTAACAGGG - Intergenic
1109771839 13:66984926-66984948 CAGCCAATGCAATGGGAACAGGG - Intronic
1109826495 13:67728366-67728388 CAGCTAACCCACAGCAAACAGGG - Intergenic
1112829772 13:103434796-103434818 CAGCTAACTGTCAGGGAACAGGG - Intergenic
1113406471 13:110045534-110045556 CTGCAAAAGTACAGCGAACAGGG - Intergenic
1113527992 13:110996538-110996560 CAGCTAAAGCAGTGTTAACAGGG + Intergenic
1114461983 14:22892319-22892341 CAGAGAAAGAAGAGGGAACAAGG + Intergenic
1114619701 14:24088084-24088106 CTTCTAAAGCACAGGGCCCAGGG - Intronic
1116182794 14:41556584-41556606 TAGCAAAAGCACAGGGAAATTGG - Intergenic
1117498235 14:56326983-56327005 CAGCTGAAGAACAAGGAAGAAGG - Intergenic
1120649557 14:87115421-87115443 CAGGGAAAGCAGAGGGAAAAGGG - Intergenic
1120962626 14:90139400-90139422 TAGCTAAGGCACAGTGAGCAAGG + Intronic
1121389064 14:93558779-93558801 CAGTTATGGCACAGCGAACAGGG - Intronic
1122700064 14:103582250-103582272 CAGCTATGGCTCAGGGACCAGGG - Intronic
1124224607 15:27882022-27882044 CAGCTAAAGCAGTGGTAAGAGGG - Intronic
1125413346 15:39427801-39427823 CAGCACAAGGACAGGGAAAAAGG - Intergenic
1125799306 15:42431014-42431036 CAGCTAAAGCACTGCTAAAAGGG - Intronic
1126710056 15:51445133-51445155 AAACTCAAGCACAGGAAACAAGG - Intergenic
1127118623 15:55751652-55751674 CTTCTAAAGCACCTGGAACAGGG - Intergenic
1128069673 15:64787074-64787096 CTGCTCTAGGACAGGGAACATGG - Intergenic
1128973662 15:72131909-72131931 CACCTCAAACATAGGGAACAGGG + Intronic
1129059564 15:72849855-72849877 AAGTTAGAGCACAAGGAACATGG - Intergenic
1130101372 15:80896847-80896869 CTCCAAAAGGACAGGGAACAGGG + Intronic
1130835336 15:87644668-87644690 TGGCTAAACAACAGGGAACAAGG - Intergenic
1131846822 15:96497213-96497235 CAACTATAGCTCAGGGAATAAGG + Intergenic
1131867325 15:96724832-96724854 CAAATAAAGCACAGGTAAGAGGG - Intergenic
1131909116 15:97177278-97177300 CAGCCACAGGAGAGGGAACAAGG - Intergenic
1132540975 16:509636-509658 CAGCTAGACCACAGGGGAAAGGG - Intronic
1133445164 16:5853417-5853439 CTCCTCAAGCCCAGGGAACATGG - Intergenic
1135961998 16:27002832-27002854 CAGCAAAAGAACCGGAAACAGGG + Intergenic
1137563652 16:49519849-49519871 CAGCTGAAGCACAGTGAATTGGG - Intronic
1138502540 16:57456678-57456700 CAGCTAAGGATCAGGGAACTTGG + Intronic
1143107034 17:4535103-4535125 CAGCTGGAGCTCGGGGAACAGGG + Intronic
1145254931 17:21317261-21317283 CACCTCAGGGACAGGGAACAGGG - Intergenic
1145259577 17:21346743-21346765 CAGCTACAGCACAAAGAACCAGG - Intergenic
1145317041 17:21741205-21741227 CAGCTACAGCACAAAGAACCAGG + Intergenic
1145321671 17:21770704-21770726 CACCTCAGGGACAGGGAACAGGG + Intergenic
1145825447 17:27873765-27873787 GAGGGAGAGCACAGGGAACACGG - Intronic
1146112423 17:30102069-30102091 CAGCAAGAGGACAGAGAACATGG + Intronic
1146445086 17:32927274-32927296 CAACTAAAGCACGGGGTTCAGGG - Intergenic
1146648625 17:34592253-34592275 CTGCAGAAGCACTGGGAACATGG - Intronic
1148243630 17:46016035-46016057 CAGCTACAGCACAGGAACCCTGG + Intronic
1149604352 17:57914398-57914420 CCTCTAAGGCACAGGGAGCAAGG - Intronic
1149857709 17:60097109-60097131 GAGCTGAAGCACAGGAAACCTGG - Intergenic
1150174608 17:63038090-63038112 CAGCCAACGCTCAGGAAACAAGG - Intronic
1150528068 17:65944962-65944984 AATCTAAAGAAAAGGGAACATGG + Intronic
1151966357 17:77433741-77433763 CATCTAACTCACAGGGAACGGGG - Intronic
1152450158 17:80373434-80373456 CAGCTGAAGCACAGAGACAAAGG - Intronic
1153136283 18:1921000-1921022 CAGATACAGCAAAGGGAAGAAGG - Intergenic
1153176256 18:2377006-2377028 CACCTATGGCTCAGGGAACAGGG - Intergenic
1154978534 18:21482778-21482800 CAGCGAAAGCACAGGGAGCATGG + Intronic
1155848074 18:30733920-30733942 CAGCTAAAGCACTGTTAAGAGGG + Intergenic
1156733357 18:40223149-40223171 CAGGTTTGGCACAGGGAACAGGG - Intergenic
1159216602 18:65399965-65399987 CAGCAAAAGCAAAGGGAAGTGGG + Intergenic
1160005313 18:75064530-75064552 CAGATGAAGCTCAGGGAACACGG - Exonic
1160157926 18:76447566-76447588 CACCCAAACCACAGGGAATACGG + Intronic
1163066308 19:14798774-14798796 CAGCAAAGGAACAGGCAACATGG - Intronic
1163485447 19:17582868-17582890 GAGGTAAAGCACAGGGGACCGGG - Exonic
1164008914 19:21179513-21179535 CAGCTAAAGCAGTGTTAACAGGG - Intronic
1165064117 19:33219230-33219252 CAGCGAAGGCTCAGGGAAGAGGG - Intronic
1166869886 19:45864639-45864661 CAGCTGAGGAACTGGGAACACGG + Intronic
1166908348 19:46132238-46132260 CAGCTATGCCACAGGGAGCAAGG - Intergenic
1167230494 19:48279888-48279910 CAGGTAAAGCACATGGAGCCAGG + Intronic
1167880816 19:52455962-52455984 TAGCTACAGCAGAGGGAGCAAGG - Intronic
1168593090 19:57652768-57652790 CAGCTAGGGAAAAGGGAACATGG - Intergenic
925796851 2:7554868-7554890 CAGCTGAAGCACAGGCAGCATGG + Intergenic
926760271 2:16272327-16272349 CAGCTAAAGCACTTTGCACAGGG + Intergenic
927187399 2:20491827-20491849 CATCTATACCACAGGGAAAAGGG - Intergenic
927317859 2:21706547-21706569 CAGGAAAGGCACAGGGAACTAGG - Intergenic
927472200 2:23385169-23385191 CAGCTAAAGCAGACGGTACCCGG + Intergenic
927791256 2:26011544-26011566 AAGCTATAGCACAGAGAACGTGG + Intergenic
928672162 2:33612752-33612774 CAGCTATGGCACAGTGAACAGGG + Intergenic
928916088 2:36472476-36472498 TAGCAAAAGCACAAGGATCAAGG - Intronic
930546207 2:52770485-52770507 CAGCTAAAGCAGTGTGAAGAGGG + Intergenic
935453384 2:103236719-103236741 CAGCAAGAGCACTGGGGACAAGG - Intergenic
935580191 2:104750048-104750070 CAGCAAAAGCACAGGGTTCCAGG + Intergenic
935606762 2:104979373-104979395 CAGCGAGAGCAGAGTGAACAAGG - Intergenic
935618988 2:105112530-105112552 CATCTCAAGCAGAGAGAACAGGG + Intergenic
935929688 2:108110774-108110796 CAGCTAAAGCAGAGTTAAGAGGG - Intergenic
936033725 2:109092588-109092610 CAGCTATGGCACAGGGAGCAGGG + Intergenic
936597989 2:113867523-113867545 AAGGTAAGGCTCAGGGAACAAGG - Intergenic
937148138 2:119664998-119665020 CAGCTAAAGCAGTGTGAAGAGGG + Intergenic
937253195 2:120536998-120537020 AAGCTAAAGCCCAGTCAACATGG - Intergenic
939860365 2:147413057-147413079 CAGCTAAAGCAGTGGTAAGAAGG - Intergenic
940087070 2:149872234-149872256 CAGCTTAAGCAAAGGGATCTGGG - Intergenic
940395493 2:153185608-153185630 CAGCTAAAGCAGTGTAAACAGGG - Intergenic
941032076 2:160524016-160524038 CAGTTTAAGCACAAGCAACAAGG + Intergenic
942034266 2:171995453-171995475 CTGCTAAAGATCAAGGAACAGGG + Intronic
944395034 2:199257252-199257274 CTCTTAAAGCACAGGGGACAGGG - Intergenic
945533226 2:210981948-210981970 CAGCTAAAGCAGTGTTAACAGGG - Intergenic
946612773 2:221477301-221477323 CAGCTCAAGCAAAGGCCACATGG + Intronic
947608188 2:231503974-231503996 CAGCTCAAGCACAGGAGAGAGGG + Intergenic
948402506 2:237693847-237693869 CAGCTAAGGCACTGGCTACAGGG + Intronic
948672371 2:239576648-239576670 CAGCAAAAGCACAGGGAAGTTGG + Intergenic
948719956 2:239893204-239893226 CAGCTGCAGCACAGGGTACACGG + Intronic
948805106 2:240450578-240450600 CAGCTAGACCTCTGGGAACAAGG + Intronic
948898591 2:240943456-240943478 TAGCTAAAAGACTGGGAACATGG - Intronic
1168945616 20:1754139-1754161 CTTCAAAAGCACAGGCAACAAGG + Intergenic
1169421819 20:5466541-5466563 CAGGTAAAGCCCAGGGATCCTGG - Intergenic
1169898370 20:10528424-10528446 CAGATAAAGGAAAGGGAAAATGG - Intronic
1169993064 20:11525069-11525091 CAGCTGGAGCAGAGGGAATAAGG + Intergenic
1170010835 20:11721896-11721918 AAGCAAAAGCAGATGGAACAAGG + Intergenic
1170011747 20:11731005-11731027 CAGCTAAAGCAGTGTTAACAGGG + Intergenic
1171200679 20:23239290-23239312 CAGCTAAAGCAGTGTGAAGAGGG - Intergenic
1171389776 20:24794105-24794127 CAGCAAAGGCACAAGGTACATGG - Intergenic
1173042172 20:39474906-39474928 CAAGGCAAGCACAGGGAACAGGG - Intergenic
1173436115 20:43033719-43033741 CAGATGAAGCACAGAGAAGATGG + Intronic
1174585963 20:51608587-51608609 CAGAGAAAACACAGGAAACATGG + Exonic
1175891100 20:62316414-62316436 CAGCTGAGCCACAGGGCACAGGG - Intronic
1178998623 21:37431590-37431612 CAGCTGAAGCCCAGGTGACAAGG - Intronic
1179398430 21:41062048-41062070 CTGCAAAAGGACAGGGAAAAGGG - Intergenic
1179929909 21:44560822-44560844 CAGCTAAAGCAGTGTTAACAGGG + Intronic
1181644283 22:24222516-24222538 CAGCTAAGGCCCAGGGACTAGGG - Intronic
1182662947 22:31937827-31937849 CAGCCACAGCACAGAGAGCAGGG - Intronic
1184800281 22:46754799-46754821 CAGCTAGAGTGAAGGGAACAGGG - Intergenic
1184981809 22:48100592-48100614 CAGCAGGAGCCCAGGGAACATGG - Intergenic
950161952 3:10766894-10766916 CAGATAAACCACAGGGAAGCAGG - Intergenic
951738436 3:25893813-25893835 TTGCTCAAGTACAGGGAACAAGG - Intergenic
952111298 3:30126726-30126748 CAGCTAAAGCACTGTTAAGAGGG - Intergenic
952694862 3:36252904-36252926 CAGCTAAAGCAGAGTTAAGAGGG + Intergenic
952715256 3:36473306-36473328 CAGATAAAGCACAGGCTATATGG - Intronic
955271138 3:57500505-57500527 TAGTTAAAGAATAGGGAACAGGG - Intronic
955435670 3:58896534-58896556 CAGCTAAAGCACTGTTAAAAGGG - Intronic
955800465 3:62680996-62681018 CAGCAGGATCACAGGGAACATGG - Intronic
956078821 3:65535497-65535519 AAGAAAAAGAACAGGGAACAAGG + Intronic
958767502 3:98387401-98387423 AAGCAAATGCACAAGGAACAAGG + Intergenic
958799530 3:98739187-98739209 CAGCTAAAGCACTGCTAAGAGGG + Intronic
959205559 3:103302342-103302364 CAGCTAAAGCAGTGGTAAGAAGG - Intergenic
959945528 3:112121894-112121916 CAGCTAAGCGACAGGGAACCTGG - Intronic
960252171 3:115468412-115468434 TAGCTAAACCACAGGCAATATGG - Intergenic
963081729 3:141401651-141401673 CTGTCAAAACACAGGGAACATGG + Intronic
964429044 3:156584736-156584758 CAGCAAAAGCATAAAGAACAAGG + Intergenic
965060048 3:163773518-163773540 CAGCTTAAGCACAGGGCACCAGG - Intergenic
965084505 3:164077476-164077498 CAGGGAAAGCAGAGGGAAAAAGG + Intergenic
965556315 3:170021795-170021817 CAGCTAAAGCCCAGCAAACAGGG - Intergenic
966133851 3:176675820-176675842 CAGCTAAAGCAGTGTTAACAGGG + Intergenic
966275106 3:178155951-178155973 CAGATATAGAACAGAGAACAGGG + Intergenic
966321717 3:178708252-178708274 CTGCTCAAGAACAGGGACCATGG + Intronic
967088354 3:186114029-186114051 CAGCCAAAGCCCTGAGAACAAGG - Intronic
967321819 3:188201944-188201966 CAGGTCAAGCAGAGGGGACAAGG + Intronic
971588318 4:28433201-28433223 CAGGGAAATGACAGGGAACATGG - Intergenic
971927548 4:33033026-33033048 CATCTAAAGAAAAGGCAACATGG + Intergenic
973107160 4:46354476-46354498 CAAGAAAAACACAGGGAACAAGG + Intronic
973539402 4:51921415-51921437 CTGCTAAAGCACAGGGCATGGGG - Intergenic
973962201 4:56122714-56122736 AAGCTAAAGCACAACAAACAAGG - Intergenic
976120000 4:81769565-81769587 TAGCTAAAGAACAAGGAACCTGG - Intronic
976156841 4:82154954-82154976 CAGCTAAAGCAGTGCGTACAGGG + Intergenic
976793058 4:88901628-88901650 CAGCTAAAGCAGTGGTAAGAGGG + Intronic
976826690 4:89268435-89268457 TGGTTCAAGCACAGGGAACAAGG + Intronic
976963953 4:91012277-91012299 CAGCTCTAGCAAAGGGGACAGGG + Intronic
977386254 4:96343294-96343316 CAGGAAAAGCACAGTAAACAAGG - Intergenic
977437817 4:97022381-97022403 CAGCTCTAAGACAGGGAACAAGG - Intergenic
978179249 4:105773510-105773532 CAGCTAAAGCAGTGTTAACAGGG - Intronic
978894787 4:113873599-113873621 CAGCTATGGCACAGGGAGCAGGG + Intergenic
979742433 4:124168031-124168053 CAGCTAATCCACAGAGACCATGG - Intergenic
980264475 4:130497377-130497399 CAACTAAAACCCAGGGACCAGGG - Intergenic
980279000 4:130693618-130693640 CAGCAAAAGTAGAGGGAGCAAGG + Intergenic
980321878 4:131290388-131290410 CAGCTATGGCACAGTGATCAGGG - Intergenic
980448141 4:132938442-132938464 CAGCTCCAACACAGGGGACAGGG - Intergenic
982072510 4:151707795-151707817 CAGCTGAAGCAGAGGGTCCATGG - Intronic
982434415 4:155367269-155367291 CAGAGAAAACACAGGGAAGAAGG + Intronic
983127696 4:163974509-163974531 CAGCTGAAGCCCAGGAATCATGG + Intronic
985542437 5:493087-493109 CAACTAAAACACAGGAGACATGG - Intronic
987314608 5:16712445-16712467 CAGCTTAATTAAAGGGAACACGG - Intronic
988622369 5:32836079-32836101 CATCTAAAACACGTGGAACAGGG - Intergenic
993096646 5:83486179-83486201 CTGCAACAGCACAGGGGACAAGG - Intronic
994068208 5:95567472-95567494 CAGCAAAAGGACAGGGAATAAGG + Intronic
994614050 5:102081070-102081092 CAGCTAAAGCACTGTTAAGAGGG + Intergenic
994726592 5:103443645-103443667 TAGGTAAAGCACATGGCACAGGG + Intergenic
995301267 5:110586027-110586049 CAGCTTAATCACAGGGAAGGGGG + Intronic
995845476 5:116489251-116489273 CAGCAGCAGCTCAGGGAACAGGG + Intronic
996194062 5:120581670-120581692 CAGCTAAAGCAGTGTTAACAGGG - Intronic
997355364 5:133259373-133259395 CAGCTGAAGCACATGGCACAAGG + Intronic
1001099071 5:168799059-168799081 CAGCTCATCCACAGGGAAAATGG + Intronic
1002121928 5:177011683-177011705 CATCAAAAGCACAGGCAACACGG + Intronic
1002428057 5:179187338-179187360 CCGCTGGAGCACAGGGAGCAGGG - Intronic
1002755047 6:150764-150786 CAGCAAAAGCACAGTAGACAAGG - Intergenic
1003182501 6:3804260-3804282 CAGGAAAAGCACAGGAAACAGGG + Intergenic
1004420208 6:15462690-15462712 CAGCTAAATGACAGTGCACAGGG + Intronic
1006586480 6:35118044-35118066 CAGCTGCAGCACAGGAAAAATGG + Intergenic
1008396750 6:51017494-51017516 CAGGTAGATCACAGGAAACATGG + Intergenic
1009194307 6:60666059-60666081 CAGCTAAGGCAAAAGGCACATGG + Intergenic
1009959209 6:70498627-70498649 CAGCTAAAGCAGTGTTAACAGGG - Intronic
1010685542 6:78850761-78850783 CAGCTAAAGAAGAGGGCACATGG + Intergenic
1011814361 6:91171375-91171397 AAGCTCAAGCTCAGGGAAAAAGG + Intergenic
1012223639 6:96680471-96680493 TGGCTAAAGCACAGGGTACAGGG - Intergenic
1013080688 6:106809279-106809301 CAGCTATGTCACAGTGAACAGGG + Intergenic
1013881193 6:114903031-114903053 CAGCTAAAGCAGTGGTAAGAGGG + Intergenic
1014246323 6:119073663-119073685 CACCTAAAGCCTAGGGAAAAAGG + Intronic
1014356960 6:120424310-120424332 CAGCTAAAGCAGTGTTAACAGGG + Intergenic
1014867011 6:126544952-126544974 CAGCTAAAACACAGATTACATGG + Intergenic
1015357366 6:132294459-132294481 CAGCTACAGCACAGTGATCCAGG - Intergenic
1015633785 6:135256008-135256030 CAGCGAAGGCACAGAGAACTTGG - Intergenic
1016106315 6:140167752-140167774 CAGCTACAGCATAGTGAAAAAGG + Intergenic
1018189179 6:161293443-161293465 GAGCTAAGACACAGGGAACAAGG + Intergenic
1018278349 6:162157215-162157237 GAGCTGGAGCACAGGGTACAGGG - Intronic
1018491551 6:164299003-164299025 CAGCCAAGGCACTGGGAATAGGG - Intergenic
1019150596 6:170003103-170003125 CAGCCACAGTACAGGGCACATGG - Intergenic
1022848183 7:34232680-34232702 CAGCTAAAGCAGTGGTTACAGGG - Intergenic
1023787222 7:43719846-43719868 AAGCTGGAGCACAGTGAACAAGG + Intronic
1024676219 7:51640091-51640113 CCCCTGAAGCACAGGGAACCAGG + Intergenic
1024757256 7:52549596-52549618 TAGCCAAAGAACAGGGAAGAGGG - Intergenic
1026360055 7:69595684-69595706 CAGTTAAAACACAGGCAAAATGG + Intergenic
1027279503 7:76596253-76596275 CAGCTAAAGCAGTGGTAAGAGGG + Intergenic
1029804967 7:102986459-102986481 CAGCTTGGGCACAGGGACCATGG - Intronic
1030024535 7:105310219-105310241 CAACTGAAGTTCAGGGAACAGGG + Intronic
1030118595 7:106083784-106083806 TAGCTAAAGGACAAGGAAAAAGG + Intergenic
1030454611 7:109757952-109757974 CAGCTAAAGCAGTGTTAACAGGG - Intergenic
1033745457 7:144312052-144312074 CATCTGAAGCATGGGGAACAAGG + Intergenic
1034505489 7:151486544-151486566 CAGCTAAAGCTCAGAGAGAACGG + Intronic
1035141795 7:156769768-156769790 CAGCTAAAGAACAGTGAGCGTGG + Intronic
1036132783 8:6131887-6131909 CAACTAAAAGAGAGGGAACAAGG + Intergenic
1036663353 8:10722527-10722549 ATGCTAAAACACAGGTAACATGG + Intergenic
1037914458 8:22764466-22764488 CAGCCAAAACCCAGGGACCAAGG + Intronic
1040436780 8:47398845-47398867 GAGCCAAAGCAAAGGGAGCATGG + Intronic
1040960059 8:53022093-53022115 CAGCTAAAGCAGTGTTAACAGGG + Intergenic
1042013761 8:64283728-64283750 CAGCAAAAGCCAAGGCAACAAGG + Intergenic
1042473393 8:69216996-69217018 CAGCTAAAGCAGAGTTAAGAGGG + Intergenic
1042644008 8:70966066-70966088 CAGCTAAAGCACTGTCAAGAGGG - Intergenic
1043706502 8:83357630-83357652 CAGCTATGGCACAGTGAACAGGG - Intergenic
1044038326 8:87334529-87334551 CAGCTAAAGCACTGTTAAGAGGG - Intronic
1044919920 8:97158164-97158186 CCTCTAAAGCACAGGGCTCAGGG - Intergenic
1045521473 8:102906518-102906540 CAGCTAAAATTCAGGGAAGAAGG + Intronic
1045705175 8:104914344-104914366 CAGCTAAAGCAAAGTTAAGAGGG - Intronic
1047766190 8:127991952-127991974 CAGCAAAGGCACCAGGAACACGG + Intergenic
1049746657 8:144265917-144265939 CAGCACAAGAACAGGGGACATGG + Intronic
1049751465 8:144286297-144286319 CAGCTAAAGCACAGGACACGCGG + Intronic
1049751480 8:144286362-144286384 CAGCTAAAGCACAGGACACGCGG + Intronic
1049751497 8:144286427-144286449 CAGCTAAAGCACAGGACACGCGG + Intronic
1049751514 8:144286492-144286514 CAGCTAAAGCACAGGACACGCGG + Intronic
1049751531 8:144286557-144286579 CAGCTAAAGCACAGGACACGCGG + Intronic
1049751547 8:144286622-144286644 CAGCTAAAGCACAGGACACGCGG + Intronic
1049756446 8:144313213-144313235 CAGCTCCAGCACAAGGATCAGGG - Intronic
1052065021 9:24007715-24007737 TTGCTAAAGCACAGGGCACTAGG + Intergenic
1052352094 9:27468466-27468488 CTGGTAAAGCAGAGGGAACAAGG + Intronic
1052760134 9:32581811-32581833 GAGCTAAAGCACAGTGGGCAGGG + Intergenic
1052767215 9:32653383-32653405 CAGCTAAAGCAGTGTTAACAGGG + Intergenic
1053516738 9:38736809-38736831 CAGCTGAAGAACAGAGATCATGG - Intergenic
1058780275 9:108325946-108325968 CACCTAAAGCAGAGGGTACAGGG - Intergenic
1059917721 9:119122349-119122371 CAGTAAGAGCACAGGGAATAAGG - Intergenic
1059954874 9:119505162-119505184 CAGCTAAAGCAGTGTGTACAGGG + Intronic
1060963333 9:127697059-127697081 CAGGTAATGCACAGGGGACCAGG - Intronic
1061672844 9:132198733-132198755 CAGGTAACGCCCAGGGAACCAGG - Intronic
1061830725 9:133292586-133292608 CAGCTATGGCACAGCGAGCAGGG - Intergenic
1061884897 9:133586477-133586499 CAGAAAGAGCACAGGGACCATGG + Intergenic
1186860299 X:13666386-13666408 CAGCTAAGTCACAGTGAGCAAGG + Intronic
1187263516 X:17709481-17709503 CTGATAAAGCACATGGAACCAGG - Intronic
1187332291 X:18352012-18352034 CACCAACAGCAAAGGGAACAGGG + Intronic
1188099896 X:26071142-26071164 CAGCTGAATCACAGAGACCACGG + Intergenic
1188148116 X:26639139-26639161 TGGCTAGAGCAAAGGGAACATGG - Intergenic
1189078428 X:37942801-37942823 TAGCTAAAGAACTGAGAACATGG - Intronic
1189087072 X:38036566-38036588 CAGTTAATGCAGATGGAACAAGG - Intronic
1189572111 X:42308993-42309015 CAGCTAAAGCACTGTTAAGAGGG + Intergenic
1189766567 X:44378334-44378356 CAGCAAAAGCAAAAGGCACATGG + Intergenic
1191842729 X:65524689-65524711 CAGCTAAATCACAACGAACATGG + Intronic
1192083040 X:68066646-68066668 CAGGTAAAGCACTTAGAACAGGG - Intronic
1192463431 X:71337535-71337557 CAGTGAAAGCAGTGGGAACAGGG - Intergenic
1193179872 X:78442034-78442056 CAGCTATGGCACAGCGAGCAGGG - Intergenic
1194016495 X:88627648-88627670 CAGCTAAAGCAGTGTTAACAGGG + Intergenic
1194044947 X:88991185-88991207 CAGAAAAAGCACAGTAAACAAGG - Intergenic
1195538963 X:106040534-106040556 GAGATAAAGCCCAGGGAATATGG - Intergenic
1195696179 X:107669329-107669351 TAGCTAAAGCATAAGGAGCAAGG - Intergenic
1196231559 X:113229530-113229552 CAGCTAAAGAAGAGGCAACTAGG - Intergenic
1197865506 X:131012494-131012516 TGGCTAAAGTACAGTGAACAAGG + Intergenic
1199711744 X:150474420-150474442 CATCTAAAGCACTTTGAACAGGG + Intronic
1199801512 X:151255707-151255729 CAACTAAAGCAGAGTTAACAGGG + Intergenic
1199830994 X:151549098-151549120 CAGCTAAAGCAGTGGTAAGAGGG + Intergenic
1200405338 Y:2804921-2804943 CAGCTAAAGCAGAGTTAAAAGGG - Intergenic
1200739998 Y:6844010-6844032 CAGCTAAAGCACTGGTAAGAGGG - Intergenic
1201940437 Y:19452972-19452994 CAGCTATGGCACAAGCAACAGGG + Intergenic