ID: 924768217

View in Genome Browser
Species Human (GRCh38)
Location 1:247053806-247053828
Sequence CTATGGGCATGGATGACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924768217 Original CRISPR CTATGGGCATGGATGACAGA TGG (reversed) Intronic
901269563 1:7941450-7941472 CTCCGGGCATGGGTGACAGAGGG + Intronic
901798963 1:11696222-11696244 CTATGGGAAGGGGAGACAGAGGG - Intronic
901880402 1:12190606-12190628 CTAGGGGCATGAATGATAGGGGG - Intronic
903570087 1:24297818-24297840 CTTTGGAAAAGGATGACAGAGGG + Intergenic
904106735 1:28090918-28090940 TTAAGGGGAAGGATGACAGAAGG - Intergenic
905925860 1:41749254-41749276 AAATGGTCATGGATGCCAGAGGG - Intronic
911245705 1:95514427-95514449 CTCCTGGCATGGCTGACAGAGGG + Intergenic
912034560 1:105295582-105295604 ATATGTGTATGGATGACACAGGG + Intergenic
913075311 1:115336960-115336982 CATTGGCCTTGGATGACAGATGG + Intronic
915916086 1:159941828-159941850 CTGTGGGAATGGATGAAAGCGGG - Intronic
918805312 1:189033303-189033325 CAATAGGCATGGATTACAGGGGG + Intergenic
921277780 1:213536642-213536664 CCTTGGGCCTGGATGGCAGAGGG + Intergenic
922910688 1:229213697-229213719 CTGTGGGCAAGGAGGAAAGAAGG + Intergenic
924632488 1:245753816-245753838 ACATGCGCATGGGTGACAGATGG - Intronic
924768217 1:247053806-247053828 CTATGGGCATGGATGACAGATGG - Intronic
1064037601 10:11927196-11927218 CTATGGAGTTGGATGACATAAGG - Intronic
1066350936 10:34636316-34636338 GTGTGGGTTTGGATGACAGAGGG - Intronic
1066725314 10:38385931-38385953 TTGTGGGGATGGAAGACAGAGGG - Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1073056719 10:100707863-100707885 CTTTGGGGCTGGAAGACAGACGG - Intergenic
1076516606 10:131048760-131048782 CTAAGGGCATTGCTGACAGCCGG + Intergenic
1076772667 10:132675055-132675077 CTTTGGGTATGGAGGACTGAGGG - Intronic
1078911295 11:15734806-15734828 TTCTGGGCATGGGTGCCAGATGG - Intergenic
1079326337 11:19495667-19495689 CTAAATGCATGGATGAGAGAGGG + Intronic
1080240801 11:30125190-30125212 CTCTGGGCAGGTATGTCAGAGGG - Intergenic
1081808149 11:45901079-45901101 CGATGGGCCTGGAAGACAAAGGG - Intronic
1082985011 11:59161023-59161045 GCAGGGGCATGGATGGCAGAGGG - Intergenic
1084568561 11:69945358-69945380 ATATGTGGATGGATGATAGATGG + Intergenic
1085021491 11:73213008-73213030 CTGTGGGCATGGAGGAAAGCTGG + Intergenic
1087923994 11:103898656-103898678 CTATGGTAATAGGTGACAGAAGG - Intergenic
1088981650 11:114870044-114870066 CTAAGGGCATTGCTGGCAGAGGG + Intergenic
1090538912 11:127678747-127678769 ATATGGTTATGGAAGACAGATGG + Intergenic
1090890059 11:130915661-130915683 CTCAGGGCATGGAGGACAGGTGG + Exonic
1091654048 12:2331838-2331860 TCATGGTCATGGAAGACAGAGGG + Intronic
1094038056 12:26091537-26091559 CTGTGGCCATGGAAGAGAGATGG - Intergenic
1096685957 12:53288455-53288477 CTAAGGGAGTGGATTACAGAAGG + Intronic
1102164847 12:110797892-110797914 ATGTGGGCATGGATGGAAGAGGG - Intergenic
1103180933 12:118910740-118910762 CTATGTGGATGGAAGCCAGATGG + Intergenic
1106620249 13:31365245-31365267 CTAGGGCCATGAATGACAGCAGG + Intergenic
1108023173 13:46150290-46150312 CTATTGGCAATGATGACAGATGG - Intronic
1108593997 13:51934924-51934946 ACATAGGCATGGATGACAGGTGG - Exonic
1108840829 13:54612634-54612656 CTATTGGCATGGATTTAAGAGGG + Intergenic
1115177593 14:30582075-30582097 CTATTAGCATAGCTGACAGAAGG - Intronic
1118589690 14:67392294-67392316 CTATGAGCAGGGAAGAGAGATGG - Intronic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1121776600 14:96594910-96594932 CTCTGGCCATTGATGAGAGAAGG - Intergenic
1122717153 14:103702539-103702561 TCATGGGCAAGGTTGACAGATGG + Intronic
1126383648 15:48072667-48072689 GTATGGACATGGATGACATGAGG + Intergenic
1128639941 15:69328739-69328761 CCAGGGGGATGGGTGACAGAGGG - Intronic
1129464771 15:75717721-75717743 CCAAGGGCATGAATGCCAGAAGG - Intergenic
1129525701 15:76212732-76212754 CTGTGGGCAAGGCTGGCAGAGGG - Intronic
1129615996 15:77099018-77099040 CCCTGGGCATGGATGAGAAAGGG + Intergenic
1129717082 15:77858807-77858829 CTGTGGGCATGGATGAGGGGAGG - Intergenic
1130375237 15:83323215-83323237 CCATGGACAAGAATGACAGATGG - Intergenic
1132090786 15:98946600-98946622 CCAAGGGCATGGGTGACAGCAGG + Intronic
1133121114 16:3608609-3608631 CTAGGGGCCTGGCTGCCAGACGG + Exonic
1133422169 16:5655091-5655113 CTAAGAGCAGGGCTGACAGATGG + Intergenic
1134502362 16:14779269-14779291 CTATGGAAATGGATGAGAAAAGG + Intronic
1134578200 16:15349625-15349647 CTATGGAAATGGATGAGAAAAGG - Intergenic
1134724391 16:16407921-16407943 CTATGGAAATGGATGAGAAAAGG + Intergenic
1134943040 16:18303938-18303960 CTATGGAAATGGATGAGAAAAGG - Intergenic
1136220733 16:28826423-28826445 CTGTGTGCATAGAGGACAGAGGG + Intronic
1136517872 16:30778711-30778733 CTATGGACATGGAGGTCAGATGG - Exonic
1140077946 16:71719678-71719700 CTATGGGCCTGGGTGACACAAGG + Intronic
1142563649 17:825897-825919 CTAAGGGCATGGAGGAGGGAGGG + Intronic
1144499248 17:15770987-15771009 CGATGGGCCTGGGTCACAGAGGG - Intergenic
1145162639 17:20586020-20586042 CGATGGGCCTGGGTCACAGAGGG - Intergenic
1145281215 17:21468335-21468357 CCAAGGGCATGGGGGACAGAGGG - Intergenic
1150299078 17:64033649-64033671 CTATGGTGATGGAAGCCAGAGGG + Intergenic
1150863194 17:68822515-68822537 TTATGGGCAGGGTTGACAGTAGG + Intergenic
1152559516 17:81070919-81070941 CAGTGGGGGTGGATGACAGAAGG + Intronic
1153660061 18:7318098-7318120 CTGTGGGCCTGGGAGACAGAAGG - Intergenic
1157000176 18:43513856-43513878 CCATGGACATGGATGAAGGAAGG + Intergenic
1159107274 18:64016753-64016775 TTATGGGTATGGAAGACAAATGG + Intergenic
1160408845 18:78661082-78661104 CTAGTAGGATGGATGACAGAAGG - Intergenic
1162300191 19:9840497-9840519 GTCTGGGCATGGTTGAGAGATGG - Intronic
1162753684 19:12844300-12844322 CTATGGGCATGGATAGAAAAGGG - Intronic
1168385131 19:55956750-55956772 TTATGGGCATGCAGCACAGAGGG - Intronic
926609381 2:14930631-14930653 CCATGGGCATGAATCACATATGG - Intergenic
926862648 2:17325309-17325331 CTATGGGAAGGGATGACAAAAGG - Intergenic
927135954 2:20096689-20096711 CTATGAGAATGGAGGGCAGAGGG - Intergenic
928102889 2:28449717-28449739 CCAGAGGCATGGCTGACAGATGG - Intergenic
930060376 2:47283631-47283653 CCATGGGCATGGGAGTCAGAAGG + Intergenic
933222754 2:79709674-79709696 CTGTGGGCATGTTTTACAGAGGG + Intronic
934861564 2:97767822-97767844 CTGTGGGCTGGGAGGACAGAAGG - Intronic
938100278 2:128493468-128493490 CTGGGGGCGTGGCTGACAGAAGG + Intergenic
938709620 2:133964984-133965006 CTTTGTGCATGGTTTACAGATGG + Intergenic
938771243 2:134502948-134502970 CTATACATATGGATGACAGAAGG + Exonic
939504593 2:143029964-143029986 CACTGGGCATGGAGGACAGGAGG + Intronic
940907902 2:159185220-159185242 CTATGGACATGGAGGGCAAATGG + Intronic
941730051 2:168907704-168907726 CTATGGGCACGGACCACAGCAGG - Exonic
945108725 2:206342765-206342787 CTATGGAGATGAATGACAGTAGG - Intergenic
946902286 2:224384145-224384167 CTGTGGGACTGGGTGACAGAGGG - Intronic
947023242 2:225707622-225707644 CTATGGTCATGAATAAAAGACGG + Intergenic
947439874 2:230109809-230109831 CTATGGGGATGGGTGAGGGATGG + Intergenic
1168736791 20:147163-147185 CTATGGGAAAAGATGCCAGAGGG - Intergenic
1170504683 20:17012968-17012990 CTATTGGGATGAATCACAGATGG + Intergenic
1171145431 20:22777332-22777354 CTAGGGGCATGGATTACAGTAGG - Intergenic
1171313879 20:24168866-24168888 TTATAGAAATGGATGACAGATGG - Intergenic
1171943806 20:31357098-31357120 CAAAGGGCATGGATCCCAGAAGG + Intergenic
1173722286 20:45269914-45269936 CTAGGGACAGGGATGACATATGG - Intergenic
1177002111 21:15625752-15625774 CTAGGGGCAGGAAGGACAGAGGG + Intergenic
1181897177 22:26120528-26120550 CTATGGGCAAGGGGGAAAGAAGG + Intergenic
1182375459 22:29843986-29844008 CCAAGGGCATGGATATCAGAAGG + Intergenic
1183307427 22:37090055-37090077 CTGGGGACATGGATGACAGCGGG + Intronic
1183359582 22:37376527-37376549 CTTTGGGCATGGAGGAAAGGAGG - Intronic
951340642 3:21482473-21482495 CCATGGGCAAGGATGACTTAGGG - Intronic
952627937 3:35429232-35429254 TTATGGGCATGGATGTTAGTAGG - Intergenic
955018071 3:55090917-55090939 CTATAAGCAGGGATAACAGAAGG + Intergenic
959683497 3:109122251-109122273 CTATGGGGATGGCTTCCAGATGG + Intergenic
963043434 3:141085420-141085442 CTATGGGAATGGAAGCCACAAGG - Intronic
963819534 3:149873315-149873337 TTATAGGCAGGGATGGCAGATGG + Intronic
964239061 3:154570107-154570129 CTTTGGGCAGGGATGGCAGGGGG + Intergenic
968869517 4:3234565-3234587 CTGTGGGCATGGAGGACTCAGGG + Intronic
972145990 4:36026352-36026374 CTATTGGCAGGGATGTCAGACGG + Intronic
972569302 4:40295814-40295836 AGATGGGAATAGATGACAGATGG - Intergenic
972769583 4:42184585-42184607 CCATGAGCATGGATGAGTGAAGG + Intergenic
974057416 4:56997932-56997954 GCATCGGCCTGGATGACAGAGGG + Intronic
977551336 4:98447035-98447057 CTGTGGGCAAGCATGCCAGAAGG - Intergenic
986549436 5:8936097-8936119 CTGTGGGCAAGTATGTCAGAGGG - Intergenic
987069168 5:14319801-14319823 GAATGGGGAAGGATGACAGAGGG + Intronic
987201334 5:15580870-15580892 GAAGGGGCATGGAAGACAGAAGG + Intronic
992953175 5:81880898-81880920 CTAATAGCATGGATGACACAGGG - Intergenic
996557332 5:124792521-124792543 CTCTTGGCCTGGGTGACAGAGGG - Intergenic
997170634 5:131716182-131716204 TTATGGTTATGGAAGACAGAAGG + Intronic
999521748 5:152358020-152358042 CTATTGGCATTTATGGCAGATGG + Intergenic
999821527 5:155233649-155233671 CTGTGGCCATTGATGACAGCAGG - Intergenic
1004445107 6:15690736-15690758 CAAAGGTCATGGGTGACAGATGG - Intergenic
1005419599 6:25635251-25635273 CTATGGGCTGGGAAGAAAGATGG - Intergenic
1005675970 6:28155218-28155240 TTATAGACATGGATTACAGATGG - Exonic
1005718379 6:28575643-28575665 CTGTTGGCATGGTTTACAGAGGG + Exonic
1006624883 6:35390313-35390335 CTATGGGGAGAGATGACAAAAGG - Intronic
1006891746 6:37434583-37434605 CCATGGGGATGGATGATTGATGG + Intronic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1009948195 6:70364437-70364459 CGATGGGCATGGCTGTCAGTGGG + Intergenic
1011528902 6:88298377-88298399 CTATGGGCAGGGGTGACATTCGG + Intergenic
1013996500 6:116314998-116315020 CTCTGGGGCTGGAAGACAGATGG - Intronic
1014357668 6:120432822-120432844 CCAAGGGAATGGGTGACAGATGG + Intergenic
1014964428 6:127729477-127729499 CTATGGGAATTGATTTCAGATGG - Intronic
1016684197 6:146863128-146863150 CAAAGGGCATGGGTGTCAGAGGG - Intergenic
1018294142 6:162327941-162327963 CTGCGGGCTTGGATCACAGACGG + Intronic
1019309758 7:354268-354290 CGATGGGCATGGGTGGCACAAGG - Intergenic
1024056435 7:45662579-45662601 CTGGGGGCAAGGATGACAGGTGG - Intronic
1025801727 7:64793297-64793319 CAATGGGCATGGATAGCGGAGGG - Intergenic
1027143392 7:75676859-75676881 CTAAGGTCATGGATAACAGTTGG - Intronic
1030870081 7:114745198-114745220 ATTTGGGCATTGATGATAGAAGG + Intergenic
1031829873 7:126613628-126613650 CCAAGGGAATGGGTGACAGACGG + Intronic
1033584315 7:142762839-142762861 ATGTGGGCATTGATGACAGCAGG - Intronic
1033969023 7:147014790-147014812 CTATGAGTATGTATTACAGATGG - Intronic
1034309140 7:150071647-150071669 CTGTGGGCCTCGAGGACAGAGGG + Intergenic
1034746956 7:153531380-153531402 ATGTGGGCAAGGATGAAAGAGGG - Intergenic
1034797715 7:154028989-154029011 CTGTGGGCCTCGAGGACAGAGGG - Intronic
1036694424 8:10965267-10965289 CTACGGGCATGGATGCAAGCAGG + Intronic
1040546763 8:48404053-48404075 CTACGGGCCTGGAGGGCAGAGGG - Intergenic
1042954375 8:74233404-74233426 CCAGGGGCATGGATTAGAGAAGG + Intergenic
1045712206 8:104998056-104998078 CTTTGGGGAAGGATGCCAGAAGG + Intronic
1048867233 8:138770037-138770059 GTATGGACATGGAGGCCAGAGGG + Intronic
1053380817 9:37648872-37648894 CTCTGGGTTTGGAAGACAGAAGG + Intronic
1053599355 9:39594320-39594342 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1053857060 9:42348506-42348528 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1054254169 9:62748066-62748088 CTATTGGTATGGAGGACAGAAGG - Intergenic
1054568234 9:66782236-66782258 CTATTGGTATGGAGGACAGAAGG - Intergenic
1056235259 9:84587991-84588013 GTGTTGGCATGGAAGACAGAGGG - Intergenic
1056654356 9:88496903-88496925 AAATGGACATGGATGAGAGAAGG + Intergenic
1061370320 9:130194079-130194101 CTAGAGGCATGGACGGCAGACGG - Intronic
1061512398 9:131069102-131069124 CTCTGGGCAGAGATGACTGATGG + Intronic
1185924456 X:4131142-4131164 CTATGGGCATCGGTGTGAGATGG - Intergenic
1190399036 X:50013297-50013319 CTGTGTGCATGGATTACAGGAGG + Intronic
1199721908 X:150548166-150548188 CTAAGGGCAGGGAGGACAGCAGG - Intergenic
1200800474 Y:7382630-7382652 TTATAGGGATGGATGATAGATGG + Intergenic