ID: 924770596

View in Genome Browser
Species Human (GRCh38)
Location 1:247076554-247076576
Sequence GCTTAGAAATTCAGGCACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924770596_924770601 22 Left 924770596 1:247076554-247076576 CCTGTGTGCCTGAATTTCTAAGC 0: 1
1: 0
2: 0
3: 11
4: 135
Right 924770601 1:247076599-247076621 ATGCTTGCAGCTCTTATACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924770596 Original CRISPR GCTTAGAAATTCAGGCACAC AGG (reversed) Intronic
902470066 1:16643027-16643049 GCTGAGAAATCCAGGGTCACAGG - Intergenic
903956745 1:27031397-27031419 GGTTAGAAATGCAGGCTCTCAGG - Intergenic
905643996 1:39611835-39611857 CCTTGGTAATGCAGGCACACGGG - Intergenic
906161311 1:43650868-43650890 GCCTAGAGATTCAAGAACACCGG - Intronic
910106229 1:83633987-83634009 CCTTAGAAATTAAGGCAGAATGG + Intergenic
913403505 1:118462301-118462323 GCTGTGAAATTGAGGCACATTGG - Intergenic
916370111 1:164082693-164082715 GATTAGAATTTCGGGGACACAGG - Intergenic
919142909 1:193595713-193595735 GCCTAGAAATTAAGGAACAAAGG - Intergenic
919725153 1:200877567-200877589 GCTTATAAACCCAGGCACAGTGG - Intergenic
921836613 1:219784986-219785008 GCTAAGGAAATCAGGCTCACAGG - Intronic
924627479 1:245707792-245707814 GCTTGGAAATCCACGCCCACCGG + Intronic
924762175 1:246998390-246998412 GCTGAGAAATTTAGGCACGTAGG + Intronic
924770596 1:247076554-247076576 GCTTAGAAATTCAGGCACACAGG - Intronic
924786015 1:247200622-247200644 ACTTAGAAATTCAGAGACTCAGG - Intergenic
1063225954 10:4015007-4015029 GCTTAGCAACTCAGACACAAAGG + Intergenic
1063262805 10:4409432-4409454 TCTGAGAAATTCCAGCACACTGG + Intergenic
1067435435 10:46273255-46273277 GCTGAGAAATTCTGGAGCACAGG + Intergenic
1072202120 10:93169415-93169437 ATTTATAAATTCAGGAACACCGG - Intergenic
1072324586 10:94285462-94285484 GCTTAAAAATGAAGACACACAGG + Intronic
1072564301 10:96604752-96604774 GCTTAGGAATTCTAGCAAACAGG + Intronic
1076600761 10:131655500-131655522 GCCTAGAAATTCTGGAACAAGGG + Intergenic
1079767521 11:24414101-24414123 GCTTTGAAATTCTGGCAGACTGG - Intergenic
1080029936 11:27649777-27649799 TCTCAGAGATTCAGGCACAAAGG + Intergenic
1081548788 11:44093346-44093368 GCCTAGAAATGTAGCCACACTGG + Intergenic
1082805986 11:57450836-57450858 GTTAAGAAAGTGAGGCACACAGG - Intergenic
1082930325 11:58596491-58596513 ACTTAGAAATTCTGGCAGAAAGG - Intronic
1087644415 11:100791155-100791177 GGTTAGAACTTCTGGTACACAGG - Intronic
1089999095 11:122938538-122938560 ACTTAAAAATTCAGTCACAAGGG - Intronic
1092213213 12:6661724-6661746 GCTTAGAAAGTGAGGTAGACAGG - Intronic
1095386075 12:41651398-41651420 GCTTTAAAATTCATGCAAACGGG - Intergenic
1095749986 12:45699170-45699192 TGTAAGAAATTCAGGCACAAAGG - Intergenic
1095858874 12:46892336-46892358 GCTTGGAATTGCAGGCGCACTGG + Intergenic
1096491149 12:52013794-52013816 GCTCAGGAATTCAGGCACCTCGG - Intronic
1097769745 12:63569940-63569962 GCTTAGAATTTCAAGCATATGGG + Intronic
1099438922 12:82677300-82677322 GTATAGAATTTCAGTCACACAGG - Intergenic
1100440318 12:94610991-94611013 ACTTTGAAATTCAGGCACTGGGG - Intronic
1102449644 12:113031383-113031405 TCCTACAAATTCAGGGACACTGG + Intergenic
1106351303 13:28933257-28933279 GCTTAGAAACTCAGGTAGAGTGG + Intronic
1107063695 13:36188878-36188900 GCTTAGAAATACAGGCTCAGAGG - Intronic
1110634994 13:77756719-77756741 GCTTAGTAATACAGCAACACAGG + Intronic
1116973314 14:51091486-51091508 GCATAGAAATTCTGGCCCATGGG + Intronic
1125473821 15:40030443-40030465 GCTATGAAACTCAGGTACACTGG + Exonic
1128193638 15:65728788-65728810 GCTTAGAAATTTAGCCAAAGGGG - Intronic
1131950676 15:97678354-97678376 GCTAAAACATTCAGGAACACTGG - Intergenic
1132200753 15:99953141-99953163 GTTTCCAAATTCAGTCACACTGG - Intergenic
1135068298 16:19330323-19330345 TCTTAGAAATGCAGGCTCTCAGG - Intergenic
1140111792 16:72011181-72011203 ACTTAGAAATGCAGGTACACAGG + Intronic
1141411889 16:83840773-83840795 CCTTTGGAATTCAGGCACAATGG - Intergenic
1143498961 17:7327813-7327835 GCTTGGAAAGTCCAGCACACTGG + Exonic
1144013501 17:11172221-11172243 GTGTAGAAATTCCAGCACACAGG + Intergenic
1151547766 17:74803641-74803663 GCTTGGGAAGTGAGGCACACCGG - Intronic
1154369223 18:13743496-13743518 TCCTAGGAATTCAGGCACATGGG - Intronic
1156667265 18:39423633-39423655 ACTTAGACATTCAGGAACCCAGG - Intergenic
1158191783 18:54837569-54837591 ACTGGGAAATGCAGGCACACGGG + Intronic
1161164357 19:2778163-2778185 GCTTAGCATTCCAGGCACACAGG + Intronic
1163110709 19:15159692-15159714 GCTTGGGAATTCAGCTACACAGG + Exonic
1166718823 19:44985983-44986005 GCTTAGAGATTCCGCCACCCAGG - Intronic
1167667952 19:50833585-50833607 GCTTATAAATTCAGGCATCCTGG - Intronic
1168067429 19:53926306-53926328 GCTTGTAACTTCAGCCACACTGG + Intronic
926420249 2:12688859-12688881 TCTTAGAAACACAGGCACAGGGG + Intergenic
926720082 2:15953512-15953534 GCTGAGAATCTCAGGCCCACTGG - Intergenic
926906186 2:17807805-17807827 GATAAGAAATTGAGGCACAGAGG - Intergenic
927840211 2:26436828-26436850 GAGTAGACATTCAGGCACTCTGG + Intronic
933917959 2:87015679-87015701 GCTTAGAATAAGAGGCACACAGG - Intronic
934005036 2:87754235-87754257 GCTTAGAATAAGAGGCACACAGG + Intronic
934537249 2:95145290-95145312 TCTTTGGAATTCAGGCACAGTGG + Intronic
938701984 2:133887769-133887791 GATTAGAAATTCAGTCAAACGGG + Intergenic
942720986 2:178952230-178952252 GCATACAAAATCAGACACACTGG - Intronic
943060821 2:183039638-183039660 ATATAGAATTTCAGGCACACTGG - Intergenic
943695411 2:190924501-190924523 AATTAAAAATTCAGGCACACAGG - Intronic
947621570 2:231594263-231594285 GCTTAGAAATAAATGCTCACTGG - Exonic
1169475246 20:5925023-5925045 GCTGAGAAATTCAGCCAAAGGGG + Exonic
1178489912 21:33043011-33043033 TCATAGTGATTCAGGCACACTGG - Intergenic
1178753573 21:35326598-35326620 GCTTTGAAATCAAGGCACAGAGG - Intronic
1179609344 21:42539812-42539834 GCTTAGAAATTCCAGCAACCAGG + Intronic
1180580694 22:16833505-16833527 GCCTAGAAATAGAGCCACACTGG - Intergenic
1181728970 22:24831025-24831047 GCCTGCAAATTCAGCCACACAGG - Intronic
1184541940 22:45131893-45131915 GTTTGGAAATGCAGACACACCGG - Intergenic
949340608 3:3026514-3026536 GATTAGAAACTAAGGCTCACAGG + Intronic
950651925 3:14412671-14412693 GGTTAGAAATTCAGGGCCCCAGG - Intronic
952531192 3:34263738-34263760 GCTTAGAAATCCAGACTCTCAGG - Intergenic
954299367 3:49691226-49691248 GCTGAGAAATCCAGGGTCACAGG + Exonic
956309076 3:67859200-67859222 AATTGGAAATACAGGCACACAGG + Intergenic
957269646 3:78012819-78012841 ACTTAGAAATCAGGGCACACAGG - Intergenic
959545279 3:107588616-107588638 AATGGGAAATTCAGGCACACAGG - Intronic
965289671 3:166863981-166864003 GATCAGAAATACTGGCACACAGG + Intergenic
970608845 4:17707358-17707380 GCTAAGAATTTCAGGCACTGTGG + Intronic
979935076 4:126683557-126683579 TCTTAGAAAATCAGGCACTGGGG + Intergenic
981452449 4:144914088-144914110 GCTAAGAAATGCAGGCAGCCTGG - Intergenic
982464150 4:155709492-155709514 TCTTAGAGCTGCAGGCACACAGG - Intronic
986541469 5:8849275-8849297 GTTTAAAAATTCAGGCAAAGTGG + Intergenic
993057615 5:83000630-83000652 GCTTAGAAACTCAGGCAGGAAGG - Intergenic
995076887 5:107995678-107995700 GCTTAGAAATTCAAGTAATCTGG + Intronic
995382545 5:111550765-111550787 GCTTAGTGAGTCAGGCGCACAGG - Intergenic
997992276 5:138554652-138554674 GCTTAGAATATCAGACACAATGG - Intergenic
998142219 5:139706390-139706412 CCTTGAAAATTCAGGCACACAGG + Intergenic
998496547 5:142595163-142595185 GCTTACAAATTCAGGCTCTGTGG + Exonic
1001174811 5:169458442-169458464 GCTGATAAATTCAGACACAAAGG + Intergenic
1001588741 5:172851219-172851241 AATTAAAAATTCAGGCACAGTGG + Intronic
1004585561 6:16996366-16996388 GCTTAGAAATCCAGGCAAGAAGG + Intergenic
1009937634 6:70252261-70252283 GATGGGAAATTCAGGCAAACCGG - Exonic
1011956473 6:93030350-93030372 GCTTAGAAATTTATGCTCCCAGG + Intergenic
1012744823 6:103072625-103072647 GCTTCTCAATTCAGCCACACTGG - Intergenic
1012828492 6:104177915-104177937 TTTTAGAAATTCAGACAGACTGG - Intergenic
1015330306 6:131970408-131970430 TCTTGGAAATTCAGTCACAAGGG + Intergenic
1018208668 6:161459548-161459570 GCCTAGAGCTTCTGGCACACAGG + Intronic
1018914331 6:168123628-168123650 GCTTAGAAATGCAGACTCTCAGG + Intergenic
1021000937 7:15329338-15329360 TCTCAGAAATCCAGGCACATAGG + Intronic
1021262647 7:18477337-18477359 GCTTAGAAATTAAGACACGCTGG - Intronic
1022367158 7:29732839-29732861 GCTTAGAATTTCAAGCATATGGG - Intergenic
1022929017 7:35091037-35091059 GCTTAGAATTTCAAGCATATGGG + Intergenic
1027986161 7:85293685-85293707 AATTAGAAATTCAGGCAGATGGG + Intergenic
1028392742 7:90334786-90334808 GCTGAGAAGTGCGGGCACACGGG + Intergenic
1028399992 7:90414886-90414908 ACTTAGAAATTCAGGGATATTGG + Exonic
1028609356 7:92692439-92692461 CCTTAGAAATTCAGGCAGCAAGG - Intronic
1028689581 7:93636619-93636641 CCTTTGGAATTCAGGCATACTGG - Intronic
1028888106 7:95957267-95957289 GCTTAGAAATTCAGTATCAGTGG + Intronic
1030192014 7:106819653-106819675 GGTCAGAGCTTCAGGCACACAGG - Intergenic
1030512804 7:110505350-110505372 GCCTAGAAAATAAGGCAAACAGG + Intergenic
1031164430 7:118212251-118212273 GTTTATAATTTCATGCACACAGG + Intergenic
1031386776 7:121161152-121161174 GCTTAGAAATCCAGGGGCAGTGG + Intronic
1032555681 7:132831780-132831802 GCATTGACATTCAGGCTCACTGG + Intronic
1037454825 8:19052815-19052837 GACTTGAAAATCAGGCACACTGG + Intronic
1037670110 8:21007623-21007645 CCTTTGAAATTCAGGCACAATGG + Intergenic
1037874756 8:22536928-22536950 GCTTGGAAATTGAAGCACAAAGG + Intronic
1038350029 8:26767654-26767676 GCTTAGAAATACAGGAAATCTGG - Intronic
1038441288 8:27572463-27572485 GCTTTGAAGTTCAGGAACTCAGG + Intergenic
1038536594 8:28358003-28358025 GCTTAGATATTCAGAACCACTGG - Intronic
1047124825 8:121948452-121948474 GCTGAGGAGTGCAGGCACACAGG + Intergenic
1047293210 8:123548295-123548317 GATTTGAAAATCAGGCACCCTGG + Intergenic
1048277212 8:133076025-133076047 GCAGAGAAACTCAGGCACATGGG + Intronic
1048598883 8:135897394-135897416 GCTTCGGAAGTCTGGCACACTGG + Intergenic
1051461347 9:17319924-17319946 GCTTAGAAATCAAGGGTCACAGG - Intronic
1054843771 9:69770893-69770915 GCTTAGATAGTCAGGGACTCTGG - Intergenic
1055001572 9:71456318-71456340 GATAAGAAAAACAGGCACACAGG + Intergenic
1056235681 9:84591692-84591714 GCTGAGAGATACAGGCACACAGG - Intergenic
1186371183 X:8949104-8949126 GCTTCCAACTTCAGGCACAATGG + Intergenic
1187562195 X:20413318-20413340 GCTTAGAAATGCAGACTCTCTGG + Intergenic
1189840377 X:45069710-45069732 GCCTAGCAATTCAGTAACACAGG + Exonic
1194175710 X:90645662-90645684 TCTTACAAATTCAGACATACAGG + Intergenic
1194193847 X:90868723-90868745 GATAAGCAACTCAGGCACACAGG + Intergenic
1195567215 X:106354989-106355011 GCTGACAAATTCATGCACAGGGG - Intergenic
1196338788 X:114571236-114571258 GCTAATAAATTCTGGCACAGTGG - Intergenic
1200522351 Y:4226620-4226642 TCTTACAAATTCAGACATACAGG + Intergenic
1200540457 Y:4451107-4451129 GATAAGCAACTCAGGCACACAGG + Intergenic
1201686558 Y:16710971-16710993 GGTAAGAACTGCAGGCACACAGG + Intergenic
1202202368 Y:22367135-22367157 GCTGAGGAGTGCAGGCACACAGG - Intronic