ID: 924771157

View in Genome Browser
Species Human (GRCh38)
Location 1:247080640-247080662
Sequence CTCTCAAAACATATGGTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924771157_924771159 -7 Left 924771157 1:247080640-247080662 CCTTGTACCATATGTTTTGAGAG 0: 1
1: 0
2: 0
3: 8
4: 144
Right 924771159 1:247080656-247080678 TTGAGAGCTTTCTTATTTTCTGG 0: 2
1: 3
2: 27
3: 148
4: 694

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924771157 Original CRISPR CTCTCAAAACATATGGTACA AGG (reversed) Intergenic
900575759 1:3381780-3381802 CTCTCTTCATATATGGTACAGGG - Intronic
907270066 1:53285819-53285841 CTCTCAGAACCTAGGGTACTTGG - Intronic
909712581 1:78668676-78668698 CTCTCAGACCAGATGGTACTTGG + Intergenic
911424458 1:97689562-97689584 CTCTTACATCATATGCTACACGG + Intronic
918038557 1:180898116-180898138 CTTTAAAAACATAGGGTTCAGGG - Intergenic
918206672 1:182315632-182315654 AACTCAAAACAGATGGAACAGGG + Intergenic
918930826 1:190854724-190854746 CTCTGAATACATCTGGTCCAGGG + Intergenic
919183538 1:194116385-194116407 CTCTCAAAGCTTATGCTATATGG + Intergenic
919888099 1:201949738-201949760 CACTGAAACCAGATGGTACAGGG - Intergenic
924771157 1:247080640-247080662 CTCTCAAAACATATGGTACAAGG - Intergenic
1063364441 10:5481109-5481131 CTCTCAGAACATCTGGTGCACGG + Intergenic
1064488660 10:15825709-15825731 ATTTCAAAACATGTTGTACACGG - Intronic
1068006169 10:51394044-51394066 TTCTCTATACATATGGTCCAGGG - Intronic
1068284335 10:54914545-54914567 AACTCAAAACATATGGAATAGGG + Intronic
1072619290 10:97068887-97068909 CTCTCAAGACATATGGGGCTGGG - Intronic
1072985797 10:100139104-100139126 CTGTCAAAAAATATGGCTCATGG + Intergenic
1073511194 10:104043580-104043602 CTCTGAAAACAGAAGGCACATGG + Exonic
1074586182 10:114769031-114769053 CTCTCAAAACAGATGTTCTATGG + Intergenic
1077510001 11:2954229-2954251 CTCTCAAAACCTAAGCTTCAGGG - Intronic
1078999108 11:16735760-16735782 CTAGCAAAGTATATGGTACATGG + Intronic
1080203110 11:29696955-29696977 CTATCAAAACATCTGGAATATGG - Intergenic
1080964323 11:37196434-37196456 CTCTCACAACATAAGGTGAAGGG + Intergenic
1081009521 11:37791542-37791564 CTATCAAAACATCTGGGACATGG - Intergenic
1083077324 11:60054550-60054572 GTGTCAAAACATGTTGTACATGG + Intergenic
1083435303 11:62639002-62639024 CCACCAAAACATCTGGTACACGG + Exonic
1085905666 11:80759036-80759058 CTATCAAAACATTTAGAACAAGG + Intergenic
1087283969 11:96244145-96244167 ATTTCAAAACATCTGGAACACGG - Intronic
1093956793 12:25229624-25229646 TCCTCAAAAAATATGGTAAAGGG + Intronic
1095610852 12:44126006-44126028 CACTCAAACCATATACTACATGG - Intronic
1096630330 12:52922334-52922356 TTATAAAAACCTATGGTACAGGG - Intronic
1099841140 12:87968725-87968747 CACTCAAAACACAAGGTTCATGG + Intergenic
1100555642 12:95690910-95690932 CTTTTAAAATATATGGTAGAAGG - Intronic
1102743932 12:115233151-115233173 TTCTAAAAACAGATGGTACAGGG + Intergenic
1103232500 12:119343518-119343540 CCCTCAAAACATCTGTCACATGG - Intronic
1108475176 13:50809192-50809214 CTTTCTAAATATCTGGTACAAGG - Intronic
1110884973 13:80621535-80621557 CTCTCAAAACAATTGTTACCAGG + Intergenic
1112622719 13:101067935-101067957 CTTTCAAATAATATGGAACATGG - Exonic
1114568834 14:23651556-23651578 CACTCAATACATCTGCTACAAGG + Intergenic
1115327556 14:32158645-32158667 GTTTCAATACATATGGGACATGG + Exonic
1115401440 14:32965631-32965653 CTCTCTAAAAATCTGGAACAAGG + Intronic
1118109820 14:62705618-62705640 GTCTCAAAACATATGAGCCATGG - Exonic
1118350054 14:64967226-64967248 CTTTCAAAACAAAAGGTCCAGGG + Intronic
1118803231 14:69210360-69210382 CAAGCAAAACATATAGTACATGG - Intronic
1123904589 15:24909132-24909154 CTCTCAATACATAAAGAACAGGG - Intronic
1126731595 15:51688957-51688979 TTCTCAAAATATGTGGTCCATGG + Intronic
1128365396 15:66996482-66996504 CTCTCAAAATATATTGTCAAAGG - Intergenic
1130617643 15:85427392-85427414 CTCTCAAAACATCATGTACTAGG - Intronic
1132242861 15:100273851-100273873 ATGTCAAAACTTATGGGACAAGG - Intronic
1137821937 16:51454397-51454419 CTCTCTAAACACATGGGACTTGG + Intergenic
1138864973 16:60806582-60806604 ATATCAAAACATATGGGATATGG + Intergenic
1146046181 17:29509884-29509906 GTCTCAAAAAATATGTTACAGGG - Intronic
1149008980 17:51835353-51835375 CTCACAAAATATATGGGTCAAGG - Intronic
1150534045 17:66016609-66016631 CTCTAAAATGATATGTTACATGG + Intronic
1154090698 18:11358974-11358996 CTCTCGAAAAATAAAGTACAAGG + Intergenic
1156779738 18:40837167-40837189 CTCTCATAAAAAATGGAACAGGG - Intergenic
1160108459 18:76002411-76002433 CAACCAAAACATATGCTACAAGG + Intergenic
1162479621 19:10920885-10920907 CTCGGAAAACATGTGGAACACGG + Exonic
1163871955 19:19829346-19829368 CTATCAAAATATCTGGTATATGG + Intergenic
1164018139 19:21270995-21271017 CTATCAAAACATCTGGGATATGG - Intronic
1164297820 19:23930095-23930117 CTACCAAAAAAAATGGTACATGG - Intronic
1166977615 19:46613926-46613948 CTTTCAAAACATAGGGCCCAAGG - Intergenic
1167904771 19:52649956-52649978 CTCACAAAAGATATGAGACAGGG + Intronic
925270409 2:2602262-2602284 CTCTCAAATCATTTAGTAGAAGG + Intergenic
927608166 2:24507810-24507832 CACACAAACCATATGCTACAAGG - Intronic
934649057 2:96078376-96078398 CTTTCAAAACATAAAGTACCAGG - Intergenic
935665006 2:105503557-105503579 CTCTCAAATCATAAGGACCAGGG + Intergenic
935932808 2:108147308-108147330 CTGTTCAAATATATGGTACACGG + Intergenic
936773774 2:115947609-115947631 CTCTCAAAACACTTGGGACCTGG + Intergenic
937733370 2:125260959-125260981 ATCTCAAAACATAAAGGACAGGG - Intergenic
940081337 2:149805644-149805666 ACCTCAAAATATATGGTAGATGG + Intergenic
947371632 2:229452541-229452563 CACTCAGAAGATATGGTACCTGG - Intronic
1169342541 20:4807393-4807415 TTTACAAAACATATGGTAAAGGG + Intronic
1170754769 20:19190665-19190687 CTTTCAAAACATAAAGTACCAGG - Intergenic
1172329958 20:34068608-34068630 ATGTTTAAACATATGGTACATGG - Intronic
1174684875 20:52445040-52445062 TTCTCAACCCATATGGTACTAGG + Intergenic
1175604188 20:60298945-60298967 CTCTCAGAACATCTGCTCCAAGG - Intergenic
1179944538 21:44662934-44662956 ATGTCAAAATATATGGAACATGG + Intronic
1182838870 22:33368121-33368143 CTCTCAGATCATTAGGTACAAGG + Intronic
1183442722 22:37832367-37832389 CTCTCAGAACATGTGGAAAAAGG - Intronic
1185243282 22:49758296-49758318 CTCTCAATACATAAAGAACAGGG - Intergenic
951304126 3:21036706-21036728 CTCTCAACATATTTGGTATAGGG - Intergenic
954879640 3:53824512-53824534 CTCTCAAAACGGATGGTTTAGGG + Intronic
957455629 3:80439721-80439743 CTCTCCAAACACAGGGGACATGG + Intergenic
963081729 3:141401651-141401673 CTGTCAAAACACAGGGAACATGG + Intronic
963337611 3:143994684-143994706 CTCTTAGAACTTAGGGTACAAGG - Intronic
963496049 3:146062642-146062664 ATCTCAATACATATGCTTCAAGG + Intergenic
965876644 3:173331319-173331341 CTCTCTAAATATCTGGTCCAGGG + Intergenic
967603885 3:191421121-191421143 CTCTTAAACCACATGGTGCATGG - Intergenic
969951791 4:10844332-10844354 CTCTCAAGACAAATGGAAAAGGG + Intergenic
972689838 4:41386105-41386127 CTCTCTACAAAAATGGTACATGG - Intronic
973930103 4:55783518-55783540 CTTTGAAAACATAGGGTTCATGG + Intergenic
975756216 4:77573916-77573938 GTCTCTAAACAGATGGCACATGG - Intronic
976089066 4:81436328-81436350 GTCTCAAAACATATTATGCAAGG - Intronic
988003178 5:25375862-25375884 ATCTCACAACATATGGTAATTGG + Intergenic
994629287 5:102263169-102263191 CACTCAAAACATATGGTGTCTGG + Intronic
994902648 5:105795623-105795645 CTCAGAAAACATGTGGTGCATGG - Intergenic
995291216 5:110456781-110456803 CTCTTAAAACAAATGGTGCTGGG + Intronic
997653457 5:135538535-135538557 CTCAAAAAACAGATGGAACAAGG - Intergenic
998698185 5:144665104-144665126 CTTTCAAAACATATAGTTTATGG - Intergenic
1001162397 5:169332159-169332181 CTCTCACAACTTGGGGTACATGG - Intergenic
1001636892 5:173216823-173216845 CTCTCAAAAAAAAAGGTCCATGG - Intergenic
1006480988 6:34293988-34294010 CTCTCAAAAAATAAGGTAAGTGG - Intronic
1008549626 6:52615239-52615261 CTGTGAAAAAATATGGTGCATGG + Intergenic
1008937997 6:57013254-57013276 CTCACAGAACATTTGTTACAAGG + Intronic
1011642534 6:89429295-89429317 TTCTCAAAACACATGAAACAAGG + Intergenic
1012727156 6:102828678-102828700 CTCTCACAAAATATGATAAAGGG + Intergenic
1013081979 6:106821201-106821223 CTCTAAAAACAAATGAGACATGG - Intergenic
1015001628 6:128223673-128223695 CTCACATAATATAAGGTACATGG - Intronic
1017385227 6:153875230-153875252 CTCTACAAAAATATTGTACAGGG - Intergenic
1017478802 6:154828580-154828602 CTCTCAAAACTAATGTGACAGGG - Intronic
1018486722 6:164247913-164247935 CTCCCATAGCATCTGGTACACGG - Intergenic
1018579810 6:165298655-165298677 ATCTCAAAACGTAAGGAACAAGG + Intronic
1021386606 7:20038799-20038821 ATTTCAAAACAGATGGTAGAAGG + Intergenic
1021558659 7:21946382-21946404 CTCCCAAAACATTTGCTACAGGG + Intergenic
1022123815 7:27336513-27336535 CTCTAAAAACATATGCTTAATGG - Intergenic
1022291842 7:29012729-29012751 TTCTCCAAACATATGCCACATGG + Intronic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1025741319 7:64198663-64198685 CTGTGAAAACATATGGTCCTGGG + Intronic
1028002992 7:85524813-85524835 CTTTCAAAACAGATAGTAAAAGG - Intergenic
1028073563 7:86482529-86482551 AGCTCAAAATATATGGTTCAGGG + Intergenic
1028481132 7:91306220-91306242 GTCTCAAGACAAATGGTAAATGG - Intergenic
1030332721 7:108289293-108289315 ATTTCAAAACATGTTGTACATGG - Intronic
1030627506 7:111859912-111859934 CACTCAAAACAAAAGGTAAAAGG - Intronic
1031419802 7:121537856-121537878 CTGTGAATACATATGGTGCATGG + Intergenic
1033858172 7:145591503-145591525 CTCTCAAAATGTAAGGTATAGGG + Intergenic
1034686431 7:152975368-152975390 TTCTCAAAACATCTGGCCCAGGG - Intergenic
1038050569 8:23806516-23806538 ATATTTAAACATATGGTACATGG + Intergenic
1038174834 8:25171354-25171376 GTCTCCAAACCTGTGGTACAAGG - Intergenic
1039688022 8:39828325-39828347 ATCTAAAAACATATGGTAATTGG + Intronic
1041745191 8:61200927-61200949 CCCCAAAATCATATGGTACATGG - Intronic
1047983710 8:130211123-130211145 CTCTCGAATCCTATGTTACAAGG + Intronic
1048791174 8:138105345-138105367 ATTTGAAAACATATGGTACATGG + Intergenic
1050560565 9:6830803-6830825 CTCTCATAACACATGGCAGAGGG - Intronic
1050606463 9:7306387-7306409 GTCCCAAGACATAGGGTACATGG - Intergenic
1051104052 9:13557834-13557856 CTCTCAAAGGGTGTGGTACAAGG + Intergenic
1053239436 9:36484776-36484798 CTCAAAAACCATATGGAACAGGG - Intronic
1053385705 9:37686011-37686033 CTCTCAAAATATTTTGTAAATGG - Intronic
1055954083 9:81757670-81757692 CCCTCTAAACATGTGGTTCAGGG - Intergenic
1056265907 9:84896704-84896726 CTCCTAAAGCATATGGTACGAGG - Intronic
1056516429 9:87355449-87355471 CTTTCAAAACATATGGGTGAAGG - Intergenic
1056748472 9:89326322-89326344 CTCATAAACCATCTGGTACAAGG + Intronic
1057100726 9:92357229-92357251 CTCTTAGAACATATGGAAAAAGG - Intronic
1057411129 9:94817304-94817326 CTTTTAGAACATAGGGTACAAGG - Intronic
1058975835 9:110124815-110124837 CACTTAAAACATATCTTACAAGG + Intronic
1189277344 X:39796640-39796662 CTCTCAAGTCATGTGGCACAAGG + Intergenic
1190897027 X:54630423-54630445 CTATCAAAACCTCTGGGACATGG - Intergenic
1193191281 X:78573761-78573783 CTGTCAAAACAGGTGGTACATGG - Intergenic
1194353023 X:92844450-92844472 CTCTCAAAACATTTACTGCATGG + Intergenic
1196927955 X:120652584-120652606 CAATGAAAACATATGGTGCAGGG + Intergenic
1197168905 X:123409647-123409669 CCCTCAAAACATATGGTATTTGG - Intronic
1197459693 X:126724699-126724721 CTCTCAAACAATACGCTACAAGG + Intergenic
1200661379 Y:5961537-5961559 CTCTCAAAACATTTACTGCATGG + Intergenic
1201674386 Y:16562797-16562819 CTCTCTCCTCATATGGTACAAGG - Intergenic