ID: 924773170

View in Genome Browser
Species Human (GRCh38)
Location 1:247094463-247094485
Sequence TTAAAGAAGTGGTAGTTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924773170_924773174 1 Left 924773170 1:247094463-247094485 CCAACCAACTACCACTTCTTTAA No data
Right 924773174 1:247094487-247094509 CATCTTGACAACTTTTTGCAGGG 0: 25
1: 56
2: 84
3: 75
4: 209
924773170_924773173 0 Left 924773170 1:247094463-247094485 CCAACCAACTACCACTTCTTTAA No data
Right 924773173 1:247094486-247094508 GCATCTTGACAACTTTTTGCAGG 0: 26
1: 54
2: 83
3: 67
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924773170 Original CRISPR TTAAAGAAGTGGTAGTTGGT TGG (reversed) Intergenic
No off target data available for this crispr