ID: 924774509

View in Genome Browser
Species Human (GRCh38)
Location 1:247106467-247106489
Sequence CCTGAAGCTCCTCCTCAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 261}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924774509_924774511 4 Left 924774509 1:247106467-247106489 CCACACTGAGGAGGAGCTTCAGG 0: 1
1: 0
2: 1
3: 23
4: 261
Right 924774511 1:247106494-247106516 CATAGAAAACTTTAATAATCAGG 0: 1
1: 7
2: 4
3: 34
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924774509 Original CRISPR CCTGAAGCTCCTCCTCAGTG TGG (reversed) Intergenic
900590634 1:3457927-3457949 CCTGCTGCTTCTCCTCAGGGTGG - Intronic
902197156 1:14806168-14806190 CCTGAAGCTCCTCAAGGGTGTGG + Intronic
902680172 1:18037892-18037914 CCACAAGCTCCTCCTAAGGGAGG + Intergenic
905012499 1:34756913-34756935 CCTGGCCCTCCTCCTCAGGGGGG - Intronic
910773331 1:90851388-90851410 CCCGAGGCTTCCCCTCAGTGGGG - Intergenic
914291267 1:146275798-146275820 CCTGACTCTCCTCCACAGAGTGG - Intergenic
914552311 1:148726581-148726603 CCTGACTCTCCTCCACAGAGTGG - Intergenic
914878377 1:151529358-151529380 CCTTAAGCTCCTCCTGTGTCCGG - Exonic
917012810 1:170494280-170494302 CCTGAAACTCCTCCTGTCTGTGG - Intergenic
917429473 1:174951073-174951095 CATGAAAATCCTCCTCACTGAGG + Intronic
917836658 1:178946597-178946619 CCTGAAGCTCCACTCCGGTGTGG - Intergenic
919980940 1:202642761-202642783 CTTCCAGCTCCTCCTCAGCGAGG + Intronic
920038187 1:203079110-203079132 GTTGCAGTTCCTCCTCAGTGTGG + Intergenic
922234704 1:223713616-223713638 CCTGAGGCTCCTCCTCCTTTGGG + Intronic
922748357 1:228059680-228059702 CCTGGAGCTCCGCCTCATTCAGG - Exonic
923454449 1:234151106-234151128 CCAGCAGCCCCTCCTCAGTGTGG - Intronic
923879806 1:238091336-238091358 TCTGCAGCTCCTCCGTAGTGGGG + Intergenic
924774509 1:247106467-247106489 CCTGAAGCTCCTCCTCAGTGTGG - Intergenic
1063352720 10:5371628-5371650 TCTGCAGCTCCTCATCAGTGTGG - Intronic
1067170916 10:43904959-43904981 CCTGAAGCTCCCCCTCTCGGAGG - Intergenic
1067578749 10:47425900-47425922 CCTTAAGCACCTTCCCAGTGAGG - Intergenic
1070794385 10:79208225-79208247 TGTGAACCTCCTCCCCAGTGAGG + Intronic
1071780491 10:88839189-88839211 CATGAATCACCTCCTCAGAGAGG + Intronic
1073366377 10:102945586-102945608 CCTGGAGCTCTGCTTCAGTGTGG - Intronic
1073705056 10:105973674-105973696 CCTGGAGCCCCTCCTCCTTGCGG - Intergenic
1076564631 10:131389741-131389763 CCTGCAGCCCCTGATCAGTGTGG + Intergenic
1077385548 11:2267970-2267992 CCTGCAGGGCCTCCCCAGTGCGG + Intergenic
1078098279 11:8313585-8313607 CCTGCAGCTGCTCTTCCGTGTGG - Intergenic
1078540106 11:12206471-12206493 CCTGAGGTTCCTACTCAGTACGG - Intronic
1078600308 11:12724712-12724734 GCAGAACCTCCTGCTCAGTGGGG + Intronic
1078884810 11:15489765-15489787 ACTGAAATTACTCCTCAGTGAGG - Intergenic
1080766748 11:35304300-35304322 CCTCAAGCTCCTCCTGAGTATGG + Intronic
1080898214 11:36463240-36463262 CCTGAAGCCCCTACTCAGCAGGG + Exonic
1084031349 11:66482449-66482471 CCTGATACTCCTCCTCGGTAAGG - Exonic
1084154277 11:67304872-67304894 CGTGGAGCTCCTCCTCACTCGGG - Exonic
1085252383 11:75152392-75152414 CCTGCAGCTGCTCCTCAGCTGGG - Intronic
1087239367 11:95757718-95757740 CCTGAAGGCCCCCCACAGTGGGG - Intergenic
1088218942 11:107546497-107546519 CCCTAAGCTCATCCTCAGTTAGG + Intronic
1088340747 11:108763302-108763324 CCTGAAGGTCATCCTCACTTGGG + Intronic
1091108818 11:132946189-132946211 CCTGAAGCTCTTCCAGTGTGAGG - Intronic
1091180063 11:133596291-133596313 TCTGCAGCTCCTGCTCAGAGTGG - Intergenic
1091194492 11:133719729-133719751 CCTGATGCTCCTGCTCACAGGGG + Intergenic
1092595346 12:9998022-9998044 CTTTAAGACCCTCCTCAGTGTGG - Intronic
1093355587 12:18162823-18162845 CCTGAAGCTTCACTGCAGTGTGG - Intronic
1095835889 12:46638239-46638261 CCTGAAGGACCTTCCCAGTGAGG - Intergenic
1096980198 12:55724211-55724233 CCTCAGTCCCCTCCTCAGTGTGG - Exonic
1097918527 12:65046089-65046111 CCTGAAGCACCTCCTCGGCCTGG + Intergenic
1099961441 12:89400961-89400983 CCTGAACATCCTCCACAATGTGG + Intergenic
1102044177 12:109819430-109819452 CCAGGAGCCCCTCCACAGTGGGG + Intronic
1102289350 12:111686125-111686147 CCTGCAGCTCAGCCTAAGTGTGG - Exonic
1106031617 13:26010305-26010327 CCAGAAGCTCCTCCTCATGATGG - Intronic
1107883507 13:44854648-44854670 CCTGCAGCCCCTCCTTAATGAGG + Intergenic
1108387337 13:49912017-49912039 TCTTAAGCTCCTCCTGGGTGTGG + Intergenic
1109164997 13:59022561-59022583 CCTGAAGCTTCTGATCACTGTGG + Intergenic
1109681454 13:65757681-65757703 CCTGAAGAAGCTCCCCAGTGTGG + Intergenic
1111195446 13:84870182-84870204 CCTCATCCTCCTTCTCAGTGTGG - Intergenic
1113173568 13:107534792-107534814 CCTGAAGCTTCTCCTCTGGATGG + Intronic
1113825644 13:113251204-113251226 CCAGAACCGCCTCCTCAGAGAGG - Intronic
1115730083 14:36259341-36259363 CCTTAGGTTCCTCCTCAGAGCGG + Intergenic
1116968998 14:51045218-51045240 CCTGGAGATCCTCCTCTGAGAGG + Intronic
1117987995 14:61407528-61407550 CTTCCAGCCCCTCCTCAGTGAGG + Intronic
1118350217 14:64968344-64968366 GCTGAAGCTAGGCCTCAGTGTGG - Intronic
1119883110 14:78117080-78117102 ACTGAGGCTCAGCCTCAGTGAGG - Intergenic
1120423266 14:84315375-84315397 CCTGAAGTTGCTCCCAAGTGTGG + Intergenic
1123116343 14:105895856-105895878 CCTGAGGCTCCACCTCAGGCTGG + Intergenic
1123118349 14:105904897-105904919 CCTGAGGCTCCACCTCAGGCTGG + Intergenic
1123436325 15:20257200-20257222 CCTGTAGACCCTCTTCAGTGGGG + Intergenic
1124344379 15:28912379-28912401 TCTAAAACTCCTCCTCAGTGAGG - Intronic
1124682028 15:31740131-31740153 CCAGAATCACCTTCTCAGTGAGG - Intronic
1125834094 15:42735819-42735841 CCTGAAGATCCCCCACAGCGAGG + Intronic
1125968164 15:43890879-43890901 CCTCAAGCTCAAACTCAGTGGGG + Intronic
1126099004 15:45108469-45108491 CCTGAAGCTGCTAATCATTGAGG - Intronic
1126225372 15:46262949-46262971 CCTGGAGCTCCATCTCAGAGAGG + Intergenic
1128775363 15:70316236-70316258 CATGTAGCTCCTGCTCAGCGTGG + Intergenic
1129035564 15:72646609-72646631 CCTGAAGCTGCAGCTCAGTCTGG - Intergenic
1129214320 15:74090607-74090629 CCTGAAGCTGCAGCTCAGTCTGG + Intergenic
1129399687 15:75274762-75274784 CCTGAAGCTGCAGCTCAGTCTGG - Intronic
1129473219 15:75766549-75766571 CCTGAAGCTGCAGCTCAGTCTGG + Intergenic
1129599271 15:76988794-76988816 TCTGCACTTCCTCCTCAGTGGGG + Intergenic
1129608958 15:77038202-77038224 CCTGCAGCAGCTCATCAGTGTGG - Intergenic
1129731464 15:77934955-77934977 CCTGAAGCTGCAGCTCAGTCTGG + Intergenic
1132993285 16:2808500-2808522 CCTGAGGCTGCTCCCCCGTGAGG + Intergenic
1133021674 16:2969615-2969637 CCCGAGCCTCCTCCTCAGTGGGG - Exonic
1133035271 16:3030785-3030807 TCTGAAGTTCCTGCTCAGTCTGG + Exonic
1136848248 16:33593666-33593688 CCTGTAGACCCTCTTCAGTGGGG - Intergenic
1136989412 16:35142961-35142983 CCTGAAGCTCCTCCTCCACCGGG + Intergenic
1137060171 16:35786499-35786521 CCTGCTGCTCCTTCTCAGTATGG + Intergenic
1137382595 16:48012940-48012962 TCTGAAGCTCCTACTGCGTGGGG + Intergenic
1137684682 16:50378587-50378609 CCTGAAGCTCAACCTCATTAGGG - Intergenic
1137925634 16:52538822-52538844 CCTTAATCTCTTCCTCAGGGAGG - Intronic
1138182365 16:54950161-54950183 TCTGCAGCTCATCCTCGGTGGGG - Intergenic
1138474936 16:57265043-57265065 CCTGGAGCTTCACCCCAGTGTGG - Intronic
1139225191 16:65227817-65227839 CCTGAAGGTCATCTTCAGGGAGG - Intergenic
1140021132 16:71239874-71239896 CCTCAAGCTCCTGCTCAGCAAGG - Intergenic
1141072390 16:80969534-80969556 CCTGCAGTTCCTCCTCACTTTGG - Exonic
1141769915 16:86083558-86083580 CATGAAGCCCCTGCTCTGTGAGG + Intergenic
1203109955 16_KI270728v1_random:1442315-1442337 CCTGTAGACCCTCTTCAGTGGGG - Intergenic
1143586512 17:7853338-7853360 CCTGAGCCAGCTCCTCAGTGCGG - Exonic
1145128144 17:20318559-20318581 CCACAAGCTGCCCCTCAGTGGGG - Intronic
1145305878 17:21674834-21674856 CCTGAAGCTCCTCCTCCACTGGG - Intergenic
1145396703 17:22502293-22502315 CCGGAAGCTTCTTCTCAGAGGGG + Intergenic
1148885419 17:50768620-50768642 CCTGAACCTCCTCCCCTGAGTGG + Intergenic
1150709651 17:67519724-67519746 CCTGGAGCTTCTCCTAAGTAGGG + Intronic
1151368291 17:73631065-73631087 CCAGAAGCGCCTCCTCTCTGGGG + Intronic
1151657711 17:75503410-75503432 CCTGCAGCTCCTCCCAGGTGAGG + Exonic
1153015728 18:580816-580838 CCTGCAGCTCCTCATCCGTGAGG - Exonic
1153589713 18:6660141-6660163 CTTGAAACTCCTGCTCAGTGAGG - Intergenic
1153675740 18:7454594-7454616 TCTGCAGCACCTCCTCAATGTGG + Intergenic
1153769409 18:8403116-8403138 CCTCAGGCTCCTGGTCAGTGTGG + Intronic
1155593461 18:27454483-27454505 CCCAAGGCTCCACCTCAGTGGGG + Intergenic
1156488497 18:37481901-37481923 CCTCGATCTCCTCCTCTGTGAGG + Intronic
1160077848 18:75694674-75694696 CCTGAAGCACCTCCTCTTTTGGG + Intergenic
1160101381 18:75923032-75923054 CTTGGAGCTCATCCTCTGTGTGG - Intergenic
1160553005 18:79707097-79707119 CCACATGCTCCTCCTCACTGGGG - Intronic
1160765819 19:807190-807212 CCTCCAGCTCCTCCTGAGCGAGG + Intronic
1161279670 19:3438968-3438990 CCTGATTCTCCTCCTCGGGGAGG - Intronic
1161355814 19:3819151-3819173 CCAGGAGCTCCTGCTCCGTGGGG + Exonic
1162104465 19:8362022-8362044 TCTGAACCTACTCCTCACTGGGG + Intronic
1162697141 19:12485027-12485049 CCTGCAGCTCCTTCTGAGCGCGG + Intronic
1163760392 19:19133170-19133192 CCCGAAGCTCCTCCTCAGACGGG + Exonic
1165032440 19:33007929-33007951 CCTGTAGATTCTCTTCAGTGGGG + Intronic
1165140773 19:33698759-33698781 CCTGTAGCTCCTCCACCGAGGGG + Intronic
1165509396 19:36257407-36257429 CCTGAAGCTCCTCCTCCACTGGG + Intergenic
1165510935 19:36266385-36266407 CCTGAAGCTCCTCCTCCACCGGG + Intergenic
1165748958 19:38248450-38248472 CTGGATGCTCCTCCTCAGGGGGG + Intronic
1166258975 19:41625110-41625132 CCTGAAGCTTCTCATCAGTGAGG - Intronic
1166976546 19:46608291-46608313 CCTGCAGCTCTGCTTCAGTGGGG - Exonic
1167288710 19:48613177-48613199 CCTGAACCTCATCCGCACTGAGG + Exonic
1167503789 19:49861148-49861170 CCTGGAGCCCCTCCCCCGTGGGG + Intergenic
1167568622 19:50272696-50272718 CCTGCAGCTCCTCCTCCTTCCGG - Exonic
927070648 2:19525232-19525254 GGTGAACCACCTCCTCAGTGAGG + Intergenic
927640263 2:24841411-24841433 GCTCCAGCCCCTCCTCAGTGAGG + Intronic
927946311 2:27137247-27137269 CCTGAAGCTCCTGGTCTGGGAGG + Exonic
928115595 2:28543336-28543358 CCTGCAGCCCCTCCTCAGCACGG - Intronic
929896675 2:45966879-45966901 GCTGTCGCTCTTCCTCAGTGAGG + Intronic
930259608 2:49129830-49129852 CCTGAAGTTCAACCTCAGTAGGG - Intronic
930698189 2:54432569-54432591 GCAGAAGCTCTTCCACAGTGAGG - Intergenic
931401812 2:61938238-61938260 CAGGAAGCTGCTCCTCCGTGGGG - Intronic
933418992 2:82023711-82023733 CCTCCTCCTCCTCCTCAGTGTGG - Intergenic
936085774 2:109467979-109468001 CCTGGAGGACCTCCTCAGAGCGG + Intronic
937053596 2:118912471-118912493 CCTGATTTTCCTCCTCAGTCTGG + Intergenic
938104762 2:128522184-128522206 CTTGATGCTCCTCCTAAATGGGG + Intergenic
941931474 2:170944887-170944909 CCTCAGGCGCCTCCTCAGAGTGG - Intronic
943719010 2:191183248-191183270 GTTGAAGCTTCTCCTCTGTGGGG + Intergenic
945852324 2:215023693-215023715 CCTTAAGCTCCTACTATGTGGGG + Intronic
947845700 2:233242013-233242035 CCTGAATCTCCACCTCAATGTGG + Intronic
948775378 2:240285508-240285530 CCTGAAGCTGCTCTTCCCTGGGG - Intergenic
948947554 2:241228791-241228813 CCTTACGCTTGTCCTCAGTGGGG - Exonic
1169918409 20:10706612-10706634 CAGAAAGCTCCTCCACAGTGCGG - Intergenic
1170483561 20:16793192-16793214 CTTGAAGCTTCACCTCAGAGGGG + Intergenic
1171544686 20:25991090-25991112 CCTGAAGCTCCTCCTCCACCAGG + Intergenic
1172948545 20:38706807-38706829 CCTGGAGCTCATCCTCTGTTGGG - Intergenic
1173233734 20:41224599-41224621 CCTCAAAGTCCTCCTCTGTGAGG - Intronic
1173868697 20:46328821-46328843 CCTGAACCTCCTCTTCCTTGAGG - Intergenic
1174402287 20:50282558-50282580 CCTGGAGCTCCTCCCCAGGTTGG + Intergenic
1174912236 20:54619566-54619588 CCTGAACGTCCCCCTCAGTGGGG - Intronic
1175391785 20:58632145-58632167 CATGGAGCTCCTTCTCAGTGGGG - Intergenic
1176231345 20:64034561-64034583 CCTGCAGCTGCTCCTCAGGACGG - Intronic
1178380443 21:32103213-32103235 CCTTGAGGTCTTCCTCAGTGAGG + Intergenic
1178620126 21:34166915-34166937 CCTGAGGCTGCACCTCAGTGGGG + Intergenic
1179096409 21:38319897-38319919 TCTGAAGCTTCTCTTAAGTGTGG - Intergenic
1179408453 21:41143980-41144002 CCTGAGGCTCCTCCTAACTCTGG + Intergenic
1179631577 21:42681975-42681997 CCTGATGCTGCTCCTGACTGTGG - Intronic
1179899269 21:44380590-44380612 GCTGATGCTCCTGCTCAGTGGGG + Intronic
1180845137 22:18976669-18976691 TCTGAGGCTGGTCCTCAGTGAGG - Intergenic
1181670894 22:24425026-24425048 CCTGAAGCACCTCCTCTCTTGGG + Intronic
1182718161 22:32376588-32376610 TCTGTAACTCCTCCTCTGTGAGG + Intronic
1183602884 22:38850326-38850348 CCTGAAGCCCCTGGTCTGTGGGG + Intergenic
1185066619 22:48635474-48635496 GCAGCAGCTCCTCCTCCGTGAGG + Intronic
950178260 3:10892007-10892029 CCTGCAGCTCCTCCATAGTTGGG + Intronic
950614078 3:14145761-14145783 CCTGCAGCACCTCCTCAGCTTGG + Exonic
950891979 3:16412390-16412412 CCTTCAGCTCTTCCTCTGTGAGG - Intronic
951728255 3:25783437-25783459 GCTGAGGCGCCTGCTCAGTGTGG - Exonic
952578628 3:34804716-34804738 CCTGAAGCTTCTCTACAGTGAGG - Intergenic
953912179 3:46898788-46898810 CGCGCAGCTCCTCCTCGGTGAGG - Exonic
954655901 3:52194143-52194165 CCTGAGGATCCTCCCCAGTGGGG + Intergenic
954708128 3:52491924-52491946 CCCCAATCTCCTCCTCACTGGGG - Exonic
958781964 3:98553355-98553377 CCTCTGGCTTCTCCTCAGTGAGG - Intronic
959031594 3:101306014-101306036 CCAGAGGCTCCACCTCAATGTGG - Intronic
961007325 3:123413710-123413732 CCTCTTGCTCTTCCTCAGTGAGG + Intronic
961494860 3:127284233-127284255 CCTGAAGCCCCACCTCAGGCTGG + Intergenic
961552629 3:127677834-127677856 CCTGAGCCCCCACCTCAGTGTGG - Exonic
963975221 3:151472902-151472924 CCTGAAGCTTCACTGCAGTGTGG - Intergenic
966658706 3:182389645-182389667 CCTGAACCACCTCATCAATGAGG + Intergenic
967796303 3:193602267-193602289 CCTGAAGCTTCTCTGCACTGTGG + Intronic
967889911 3:194357649-194357671 CCTGGAGCTCCTCCTGCGTGTGG - Intronic
968869197 4:3232949-3232971 CAGGGAGCCCCTCCTCAGTGAGG + Intronic
969259794 4:6026020-6026042 CCTGATCCCCCTCCTCAGGGCGG + Intergenic
972133500 4:35863955-35863977 CCTGAAGCCCCTTCGGAGTGGGG - Intergenic
973822422 4:54674217-54674239 CCAGCAGCTTCTCCCCAGTGTGG + Intronic
978768795 4:112432315-112432337 ACTCCAGCTCATCCTCAGTGTGG + Exonic
979545208 4:121932609-121932631 CCTGCAGCTCCTGCTCACAGGGG + Exonic
981121276 4:141053489-141053511 CCTGAAGAAGCTACTCAGTGTGG - Intronic
983815855 4:172126548-172126570 CCTGGAGCGGCTCCCCAGTGTGG + Intronic
985007130 4:185545018-185545040 CCTGAAGCTCTGCCTCAGATTGG + Intergenic
989691390 5:44149145-44149167 CCTGACACTCCTCATGAGTGGGG - Intergenic
989768573 5:45115693-45115715 CCTGCTGCTCTTGCTCAGTGAGG + Intergenic
991636074 5:68707255-68707277 CCTGAATCTCCTTCTCAGAAGGG + Intergenic
993413907 5:87602159-87602181 CCTGAAACTCCTTCTCAGGGAGG + Intergenic
994803540 5:104412941-104412963 CCTGAGCTTCCTCTTCAGTGGGG - Intergenic
995187807 5:109290146-109290168 CCTGGAGGACCTCCCCAGTGAGG - Intergenic
995705086 5:114980378-114980400 CCTAAAGCACCTTCTCTGTGTGG + Intergenic
995786465 5:115835554-115835576 CCTGAAATTTCTCCTCAGTATGG + Intronic
995809852 5:116093409-116093431 CCTGGAGAGGCTCCTCAGTGTGG + Intronic
995888142 5:116919007-116919029 CCTGAAGCTTGTACTCAGAGAGG - Intergenic
996661511 5:126009096-126009118 CCCAAGGCTCCACCTCAGTGGGG - Intergenic
997811923 5:136978972-136978994 CCTGAAGACTCACCTCAGTGGGG - Intronic
999855857 5:155593047-155593069 CCTGTATCTACTCCTCAGAGTGG + Intergenic
1001200752 5:169714107-169714129 GCTGGAGCTCCTGCTCAGCGTGG - Exonic
1001851384 5:174969892-174969914 CCTGAAGCACATCGTCAGTGTGG + Intergenic
1002571748 5:180143497-180143519 CCTGCTGTTCCTCCTCAGCGTGG + Intronic
1002823709 6:753747-753769 CCACATGCTCCTCATCAGTGTGG + Intergenic
1002873392 6:1188237-1188259 ACTGAAGCTCATCCCTAGTGAGG + Intergenic
1003393234 6:5731361-5731383 CCAGACTCTCCTCCTCTGTGAGG + Intronic
1003691177 6:8355158-8355180 CCTGAACCTGCTCTACAGTGAGG - Intergenic
1005799891 6:29410182-29410204 CCAGAAGTTCCCACTCAGTGAGG - Intronic
1006613069 6:35306880-35306902 CCTTAGTCTCCTCCTCTGTGAGG - Intronic
1008222673 6:48874700-48874722 CCTCCTCCTCCTCCTCAGTGTGG - Intergenic
1009664300 6:66655498-66655520 CCTGAGCCTCCCCCTCACTGTGG - Intergenic
1011184178 6:84656060-84656082 CCTGAAGGACCTTCCCAGTGGGG + Intergenic
1013478700 6:110533331-110533353 CCTGAAGCTGGTACTCAGGGTGG - Intergenic
1017597866 6:156048648-156048670 CGTTAAGCTCCTCATAAGTGTGG + Intergenic
1017910610 6:158789443-158789465 ACATAAGCTGCTCCTCAGTGTGG + Intronic
1018047164 6:159975473-159975495 TCTTAAGATCCTCCCCAGTGAGG - Intronic
1018455951 6:163952276-163952298 CCTGGATCTCCTGGTCAGTGTGG - Intergenic
1020211208 7:6159311-6159333 CCTGAGGCCACTCCCCAGTGAGG - Intronic
1021627099 7:22604032-22604054 CCTGCAACTCCTCCTTACTGAGG + Intronic
1023097996 7:36682207-36682229 CCAAAAGTTACTCCTCAGTGTGG - Intronic
1023866836 7:44242370-44242392 CCTGAAGCTCCCTCTCAGGCAGG + Intronic
1025283821 7:57647252-57647274 CCTGAAGCTCCTCCTCCACTGGG - Intergenic
1025296082 7:57776155-57776177 CCTGAAGCTCCTCCTCCACCAGG + Intergenic
1025929073 7:65980598-65980620 CCAGGAGTTCCTCCTCAGAGTGG + Intronic
1026300826 7:69096605-69096627 ACTCAAACTCCTCCTCAGAGTGG + Intergenic
1027124865 7:75549188-75549210 CCTCATGCTCCTCCTCACTCAGG + Intronic
1029167805 7:98606777-98606799 CCTGTAGCTCCTCTTTGGTGAGG + Intergenic
1030358463 7:108569624-108569646 CCTGTGGCGCATCCTCAGTGAGG - Exonic
1033469149 7:141628634-141628656 CTTGAATCTCCCACTCAGTGAGG + Intronic
1034459474 7:151190648-151190670 CCTGAATCTCTTCCTCCTTGAGG - Intergenic
1034787437 7:153937843-153937865 CCTGGAGCTGCCCCTCAGAGTGG + Intronic
1034923076 7:155099582-155099604 CCTGGAGCTCCTCCCCAGCTGGG - Intergenic
1035252501 7:157606327-157606349 GCTGTAGCTCCTCCCCAGCGTGG + Intronic
1035299002 7:157885104-157885126 CCTCAAGCTACTACTCTGTGTGG - Intronic
1038679433 8:29653164-29653186 CTTGGAGCTCCTCATCAGTAAGG - Intergenic
1039175861 8:34805121-34805143 TCTGATGATGCTCCTCAGTGAGG + Intergenic
1039482136 8:37882094-37882116 CCTGAAGCTCCTGCCCTGGGCGG - Intronic
1040915170 8:52561755-52561777 CCTTAAGCTCCATGTCAGTGAGG + Intronic
1040939168 8:52815324-52815346 CCTGAAGCCCCAGCTCTGTGTGG - Intergenic
1041007058 8:53505530-53505552 GCTGGAGCTGCTCCTTAGTGAGG + Intergenic
1046695277 8:117332882-117332904 CCTGCTGCACCTCCGCAGTGAGG - Intergenic
1049206443 8:141365801-141365823 CCTGACGCCCCTCCTCAGGGAGG + Intronic
1049342363 8:142120027-142120049 TCTGAAGTCCCTCCCCAGTGGGG - Intergenic
1049602966 8:143516395-143516417 CCTGAGGCTGCTCCGCAGGGTGG + Intronic
1050038449 9:1462401-1462423 CCTGGAGCTGGTGCTCAGTGGGG + Intergenic
1050671393 9:8001531-8001553 CTATAAGGTCCTCCTCAGTGAGG - Intergenic
1052877607 9:33578965-33578987 CCTGTAGCTTTTCCACAGTGGGG + Intergenic
1053165795 9:35842696-35842718 CCTGGAGCTCCAGCTCAATGCGG + Exonic
1053498381 9:38565243-38565265 CCTGTAGCTTTTCCACAGTGGGG - Intronic
1053664169 9:40305890-40305912 CCTGTAGCTTTTCCTCACTGAGG + Intronic
1053665136 9:40312095-40312117 CCTGTAGCTTTTCCTCACTGAGG + Intronic
1053913231 9:42926231-42926253 CCTGTAGCTCATCCACACTGAGG + Intergenic
1053914715 9:42937142-42937164 CCTGTAGCTTTTCCTCACTGAGG + Intergenic
1054376296 9:64452125-64452147 CCTGTAGCTTTTCCTCACTGAGG + Intergenic
1054520447 9:66070395-66070417 CCTGTAGCTTTTCCTCACTGAGG - Intergenic
1056444689 9:86654319-86654341 ACTGAAGCTCCTTTACAGTGAGG - Intergenic
1056754844 9:89375172-89375194 CAGGAAGCTCCTCCTCGGTGGGG - Intronic
1057677843 9:97149730-97149752 CCTGTAGCTTTTCCACAGTGAGG - Intergenic
1059077522 9:111209928-111209950 CCTGATGCTCTTCCTCCCTGTGG - Intergenic
1060952426 9:127612557-127612579 CCTGAGGCTCCTGGTCCGTGGGG + Intronic
1061029035 9:128068559-128068581 CCTGGAGCTCGCCCTCGGTGCGG - Exonic
1061406306 9:130394671-130394693 GCTGAAGCACCTCCTCTGTGTGG + Intronic
1061594391 9:131619508-131619530 CTTGGAGCTGCTCCTCTGTGGGG + Intronic
1062366791 9:136213752-136213774 CCTGAGAGTCCACCTCAGTGTGG - Intronic
1062711930 9:137979719-137979741 CCAGAATCTCATCCTCAGTTAGG + Intronic
1188301007 X:28505627-28505649 CCCGAAGCTCGGCATCAGTGAGG + Intergenic
1188869716 X:35359158-35359180 CCTGGAGGACCTGCTCAGTGAGG + Intergenic
1189307433 X:39997448-39997470 CCTCCAGCTCCTCTTCATTGCGG + Intergenic
1192067816 X:67904543-67904565 CTGGAAGCTCCTTCTCAGTGGGG + Intergenic
1193789145 X:85797420-85797442 CCTGGAGGACCTTCTCAGTGAGG + Intergenic
1193809486 X:86034982-86035004 CCAGCAGTTACTCCTCAGTGTGG - Intronic
1196020235 X:110983709-110983731 TCTTAAGCTTCTCCTCACTGAGG - Intronic
1196234971 X:113269069-113269091 AGTTATGCTCCTCCTCAGTGAGG - Intergenic
1199844199 X:151678991-151679013 CTTGCAGCTCTTCCTCAGGGAGG + Intergenic
1199966953 X:152828536-152828558 CCTGCAGCTCCTCATCAGTCAGG + Exonic
1200062672 X:153490529-153490551 CATGAAGCTCATGCTCAGCGGGG - Intronic
1200962683 Y:9009707-9009729 CCTGAAGCACCTGCTCAGCTGGG - Intergenic
1202150392 Y:21838804-21838826 CCTGAAGCACCTGCTCAGCTAGG + Intergenic