ID: 924775104

View in Genome Browser
Species Human (GRCh38)
Location 1:247111133-247111155
Sequence CCCGGCGGGTACCCCGAGTC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 2, 1: 7, 2: 7, 3: 17, 4: 68}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924775104_924775111 -9 Left 924775104 1:247111133-247111155 CCGGACTCGGGGTACCCGCCGGG 0: 2
1: 7
2: 7
3: 17
4: 68
Right 924775111 1:247111147-247111169 CCCGCCGGGTGGTGTGGGGCTGG 0: 6
1: 21
2: 29
3: 53
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924775104 Original CRISPR CCCGGCGGGTACCCCGAGTC CGG (reversed) Exonic