ID: 924775104

View in Genome Browser
Species Human (GRCh38)
Location 1:247111133-247111155
Sequence CCCGGCGGGTACCCCGAGTC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 2, 1: 7, 2: 7, 3: 17, 4: 68}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924775104_924775111 -9 Left 924775104 1:247111133-247111155 CCGGACTCGGGGTACCCGCCGGG 0: 2
1: 7
2: 7
3: 17
4: 68
Right 924775111 1:247111147-247111169 CCCGCCGGGTGGTGTGGGGCTGG 0: 6
1: 21
2: 29
3: 53
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924775104 Original CRISPR CCCGGCGGGTACCCCGAGTC CGG (reversed) Exonic
900109924 1:1001119-1001141 GCCGCCGGGGACCCCGAGTGCGG - Intergenic
902956991 1:19932184-19932206 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
904242421 1:29156755-29156777 CCCGTAGGGTACCCAAAGTCTGG + Intronic
908293264 1:62688485-62688507 CCCGGCGGGAACCCCGGCTGCGG + Intergenic
916218507 1:162419894-162419916 CCCAGAGGGTACCCGGAGTCCGG - Intergenic
924775104 1:247111133-247111155 CCCGGCGGGTACCCCGAGTCCGG - Exonic
1063929942 10:11018409-11018431 CCGGGCGGGGTCCGCGAGTCCGG + Intronic
1064782368 10:18856671-18856693 CCCAGCAGGTACCCCGAGTCCGG + Intergenic
1070140321 10:73733387-73733409 CCAGGCGGGCGCCCCGAGACGGG + Intergenic
1074703979 10:116115398-116115420 CCTGGCAGGTTCCCAGAGTCAGG + Intronic
1078317825 11:10306744-10306766 CCCTGCGGAGACCCTGAGTCCGG + Exonic
1088802008 11:113314837-113314859 CCCGGCGGGCAGCGCGCGTCTGG + Intronic
1091963613 12:4720033-4720055 CCCAGCGGATACCCCGAGTCCGG + Intronic
1092871560 12:12810313-12810335 CCCGTAGGGTACCCAAAGTCCGG + Intronic
1095095366 12:38145008-38145030 GCCAGTGGGTACCCCGAGTCCGG - Intergenic
1105039341 12:132949524-132949546 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1107247918 13:38319747-38319769 CCCAGCGGGTACCCCGAGTCCGG + Intergenic
1111195373 13:84869689-84869711 CCCAGCAGGTATCCCAAGTCTGG - Intergenic
1115889554 14:38011573-38011595 CCCGGCAGGTTCCCCAAGTCCGG - Intronic
1116683794 14:48011733-48011755 CCCGGCGGGTACCCCGAGTCCGG - Intergenic
1120036801 14:79706978-79707000 CCCGTAGGGTACCCGAAGTCCGG - Intronic
1122523442 14:102363077-102363099 CCCGGCGGGGCCGACGAGTCCGG + Exonic
1122775884 14:104116846-104116868 CCCGGCGGGGACCCAGAACCCGG + Intergenic
1125834290 15:42736585-42736607 CCCCGCGGCTACCCCGCGGCGGG + Exonic
1128344058 15:66842653-66842675 GCCTGCGGGCGCCCCGAGTCTGG + Intergenic
1132603571 16:784424-784446 CCCGGTGGGGACTCCGGGTCTGG + Intergenic
1132603593 16:784496-784518 CCCGGTGGGGACTCCGGGTCTGG + Intergenic
1135032504 16:19049726-19049748 CCCGCCGGCTGCCCCGAGGCTGG + Intronic
1135075937 16:19393607-19393629 CCCAGTGGGTACCCTGAGTCTGG + Intergenic
1144021245 17:11241341-11241363 CGCGGCGGGTCCTCCGAGCCCGG + Exonic
1144958087 17:19029688-19029710 CCCAGAGGGTAGCCCCAGTCTGG - Intronic
1144977071 17:19144832-19144854 CCCAGAGGGTAGCCCCAGTCTGG + Intronic
1147587290 17:41659797-41659819 CCCAGCAGGTACCCAGAGCCAGG + Intergenic
1147943469 17:44066433-44066455 CCCTGCGTGAAGCCCGAGTCCGG - Intronic
1148032146 17:44628749-44628771 CTGGGCTGGTACCCCGAGTCAGG + Intergenic
1148323565 17:46771298-46771320 CGCGGCTGGGACCCCGAGGCCGG - Intronic
1148782529 17:50129919-50129941 CCAGGCGGGGGCCCCGCGTCCGG - Intergenic
1152571220 17:81122078-81122100 CTCGGCGGGGCCCCTGAGTCTGG - Exonic
1153388469 18:4527644-4527666 CCCAGCGGGTACCCCGAGTCCGG + Intergenic
1160948260 19:1653239-1653261 CCCGGCGGGAAAACCGACTCTGG + Intergenic
1162079169 19:8208734-8208756 CACCCTGGGTACCCCGAGTCTGG - Intronic
1162934765 19:13976429-13976451 CCCGGCGAGGAGCCCGAGCCGGG + Intronic
1163636069 19:18437701-18437723 CCCGGCAGGTGCCCCGGCTCGGG - Exonic
1164609490 19:29622423-29622445 CCCAGCAGGAAACCCGAGTCAGG + Intergenic
1165258609 19:34595190-34595212 CCCGTAGGGTACCCGAAGTCTGG + Exonic
1165895625 19:39139354-39139376 CCCGCTGGGTACCCCGACACTGG - Intronic
1166897208 19:46031421-46031443 CCCGTAGGGTACCCAAAGTCCGG - Intergenic
932042941 2:68319384-68319406 CCCGGCAGGTCCCCCATGTCTGG + Exonic
933066809 2:77808138-77808160 CCCAGTGGGTACCCCAAGTCCGG - Intergenic
933362355 2:81304456-81304478 CCCAGCTGGTACCCCAAGTCCGG + Intergenic
933418910 2:82023196-82023218 CCCAGTGGGTACCCTGAGTCTGG - Intergenic
933419855 2:82031232-82031254 CCCAGTGGGTACCCTGAGTCTGG - Intergenic
937715155 2:125024234-125024256 CCCAGTGGGTACCCTGAGTCCGG + Intergenic
937862574 2:126722551-126722573 CCCTGGGGATTCCCCGAGTCTGG + Intergenic
942830989 2:180237390-180237412 CCCAGCGGGTACCCGGAGTCTGG - Intergenic
943833208 2:192487900-192487922 CCCAGCGGGTACCCCGAGTCCGG - Intergenic
943960439 2:194256185-194256207 CCCGGCCGGTACCCCGAGTCCGG + Intergenic
947650213 2:231780724-231780746 CCCGGCCGGGACCCAGAGGCCGG - Intronic
1169083029 20:2809078-2809100 CCTAGCGGTTACCCCGAGTCCGG + Intergenic
1169483528 20:6006531-6006553 CCCGGCGAGCACCCCCAGCCTGG + Exonic
1181581700 22:23832386-23832408 CCTGGCGCCTCCCCCGAGTCCGG + Intronic
1182355601 22:29721082-29721104 CCCTGCGGGGACCCCCAGCCCGG + Intronic
1183201211 22:36387128-36387150 CCCGCCGGGTCCCCCTTGTCCGG + Intronic
1184548333 22:45189239-45189261 CCCGTAGGGTACCCGAAGTCTGG - Intergenic
1184737896 22:46409907-46409929 CCGGGCGGTTCCTCCGAGTCAGG - Intronic
950193143 3:10992030-10992052 CCCAGCTGGTACCCAGAGCCTGG + Intergenic
955419793 3:58724789-58724811 CCCGTAGGGTACCCGAAGTCCGG - Intronic
957694551 3:83618435-83618457 CCCAGCGGGTACTCCGAGTCCGG + Intergenic
962816579 3:139006106-139006128 CCCGGCGGGTACCCCGGCCGTGG - Exonic
968653036 4:1767486-1767508 CCCGGTGGGGACACCGAGGCCGG - Intergenic
976306544 4:83565694-83565716 CCCGGTGGGTACCCCGAGTCCGG + Intronic
979126607 4:116980760-116980782 CCCAGCGGGTACCCCGAGTCCGG - Intergenic
981354962 4:143778284-143778306 CCCGTAGGGTACCCAAAGTCTGG - Intergenic
983327431 4:166274578-166274600 CCCAGCGGGTACCCCGAGTCCGG - Intergenic
997272944 5:132557056-132557078 CCCGGCGGGCAGCCCCAGGCTGG + Exonic
997297683 5:132777789-132777811 CCCGGCGGGACCCGCGCGTCCGG + Intronic
1005721674 6:28608400-28608422 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1012996539 6:105981253-105981275 CCGGGCAGGGACCCCGAATCCGG + Intergenic
1020939216 7:14509780-14509802 CCCAGCAGGTACCCCGAGTCTGG - Intronic
1028192262 7:87867028-87867050 CCCAGTGGGTACCCCAAGTCTGG - Intronic
1033669104 7:143472697-143472719 CCCAGCGGGTACTCCGAGTCCGG - Intergenic
1034367168 7:150561096-150561118 ACCTGCGGGTACCCAAAGTCTGG + Intergenic
1036683932 8:10895702-10895724 CCCGAGGGGACCCCCGAGTCAGG + Intergenic
1040138433 8:43882515-43882537 CCCCGTGGGTGCCCCTAGTCTGG + Intergenic
1040787072 8:51178618-51178640 CCCAGAGGGTACCCTGAGTCTGG + Intergenic
1043295335 8:78654629-78654651 CCCAGTGTGTACCCCAAGTCCGG - Intergenic
1049637591 8:143697400-143697422 CCCGGGGGGTACCGCGACTGTGG - Intronic
1056593411 9:87984170-87984192 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1057128593 9:92638067-92638089 CCGGGCAGGCACCCTGAGTCCGG - Exonic
1062422688 9:136490957-136490979 GCCGGCGTGAACCCCGAGTGTGG - Intergenic
1203769099 EBV:40153-40175 CCCGGCGGCTACCCCCAGGGTGG - Intergenic
1195295217 X:103469896-103469918 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1201783215 Y:17745357-17745379 CCCAGTGGGTACCCTGAGTCTGG - Intergenic
1201783927 Y:17752884-17752906 CCCGGCAGGTACTTTGAGTCTGG + Intergenic
1201817626 Y:18153103-18153125 CCCGGCAGGTACTTTGAGTCTGG - Intergenic
1201818338 Y:18160630-18160652 CCCAGTGGGTACCCTGAGTCTGG + Intergenic
1202113909 Y:21451813-21451835 TCCGGCAGGTACCCCGAGTCCGG + Intergenic
1202174576 Y:22085606-22085628 CCCAGTGGGTACCCCGAATCTGG - Intronic
1202216784 Y:22500776-22500798 CCCAGTGTGTACCCCGAATCTGG + Intronic
1202326403 Y:23695294-23695316 CCCAGTGTGTACCCCGAATCTGG - Intergenic
1202544369 Y:25974760-25974782 CCCAGTGGGTACCCCGAATCTGG + Intergenic