ID: 924775378

View in Genome Browser
Species Human (GRCh38)
Location 1:247112027-247112049
Sequence AGTCCACGCGGGCCGCCGAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 40}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924775378_924775387 17 Left 924775378 1:247112027-247112049 CCTCTCGGCGGCCCGCGTGGACT 0: 1
1: 0
2: 0
3: 5
4: 40
Right 924775387 1:247112067-247112089 CCACGCTGCCCTCGTGCCCGCGG 0: 1
1: 0
2: 4
3: 7
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924775378 Original CRISPR AGTCCACGCGGGCCGCCGAG AGG (reversed) Exonic
905824044 1:41015998-41016020 AGCCCATGCGGGCTGCTGAGAGG - Exonic
910193868 1:84621106-84621128 GGGGCACGCGGGCGGCCGAGCGG + Intergenic
918451683 1:184664792-184664814 ACTCAACGCGGGCTGCCCAGAGG + Intergenic
920705059 1:208244484-208244506 AGTCCGCGCGGGCGGGGGAGGGG - Intergenic
924775378 1:247112027-247112049 AGTCCACGCGGGCCGCCGAGAGG - Exonic
1064354239 10:14603833-14603855 GGTCCACGCCGGGCGCCGCGGGG + Intronic
1065101359 10:22335628-22335650 CGTCCACCCGGAGCGCCGAGGGG - Intergenic
1076839615 10:133039575-133039597 CGTCCACACGGGCTGGCGAGGGG - Intergenic
1077173103 11:1177088-1177110 GGGCCACGGGGGCCGCCGTGAGG - Intronic
1086361894 11:86068806-86068828 AGTCCCCGCCGGCTGCTGAGCGG - Exonic
1096789100 12:54034134-54034156 AGGCCACGCGGGCCGCAGGCGGG - Intronic
1096791421 12:54047450-54047472 GGTGCGCGCCGGCCGCCGAGGGG + Intronic
1102254035 12:111405963-111405985 AGTCCGGGCGGGCAGCCGGGCGG - Exonic
1113874427 13:113585222-113585244 GGTCCCCGCGGGCCGCCGTGGGG - Intronic
1113944399 13:114035701-114035723 GTTCCACGCCGGCCGCAGAGAGG + Intronic
1119325865 14:73759387-73759409 AGCCGCCGCGGGCCGCCGGGTGG + Intronic
1131825840 15:96322193-96322215 AGGCTGCGCGGGCCGCCGCGGGG - Intergenic
1132643134 16:987126-987148 AGCCCACCCGGACCCCCGAGCGG + Intergenic
1141847641 16:86621829-86621851 AGTCCATGCTTGCCGCAGAGAGG - Intergenic
1150158695 17:62875498-62875520 AGTCCAGGCGGGCTGGGGAGGGG + Intergenic
1153457323 18:5295574-5295596 GGGCCGCGCGGGCCGGCGAGCGG - Intronic
1162778775 19:12995969-12995991 AGAGCCCGCGGGCCGCCGAGGGG + Intronic
1163155654 19:15438799-15438821 AGCCCCAGCGGGCCGCCCAGCGG + Intronic
1164929682 19:32165883-32165905 AGGCCACGCGTGTCCCCGAGTGG + Intergenic
1165469264 19:35994101-35994123 TGTCCCCGCGGGCCGCCTGGAGG - Intergenic
1166558908 19:43719209-43719231 AGTCGTAGCGGGCCGGCGAGAGG - Exonic
1167427078 19:49434812-49434834 AGTGGACGCGGGCAGCTGAGGGG + Exonic
927514409 2:23663403-23663425 CGTCCACTCGGGCCGCCCCGCGG + Intronic
932739912 2:74283460-74283482 AGTCCCTGCGGGCCTCAGAGAGG - Intronic
942461599 2:176172118-176172140 AGTCCACGCTGGCCGACGACGGG - Exonic
1171013008 20:21518666-21518688 AGGGCACGGGGGCCGCCCAGAGG + Intergenic
1174355966 20:49998126-49998148 AGGCCATGCGGGCCTCGGAGTGG + Intergenic
1180216000 21:46324197-46324219 ACTCCGCGCGGGCCGCCCGGCGG - Exonic
971327391 4:25655570-25655592 AGGGCGCGCGGGGCGCCGAGGGG + Intronic
976892780 4:90070609-90070631 AGTCCACCCGGGGCAGCGAGTGG - Intergenic
985571127 5:645889-645911 CGTCCACACAGGCCGCCGACGGG - Intronic
985571147 5:646019-646041 TGTCCACACAGGCCGCCGATGGG - Intronic
985791520 5:1930936-1930958 AGTCTACGGGGGTCGCCGGGTGG - Intergenic
1019711331 7:2519530-2519552 AGCCCCTGCGGGCCGCCGAGGGG - Intronic
1029849332 7:103446072-103446094 AGTGCGCGCGGGCGGCCGCGGGG - Intronic
1047998305 8:130357570-130357592 GGTCCAGTCGGGCCGCTGAGGGG + Intronic
1048550298 8:135427543-135427565 AGTCCATGCCGGCGGCTGAGAGG - Intergenic
1049154252 8:141057150-141057172 AGTCCTGGAGGGCCGCCGTGGGG - Intergenic
1054765000 9:69035885-69035907 AGGCCACGGCGGCCGCAGAGTGG - Exonic
1189002763 X:36963673-36963695 GGTCCCCGCGGGCCGCCGTGGGG + Intergenic
1189271374 X:39754737-39754759 AGTCCACTCTGGCTGCCGGGTGG + Intergenic