ID: 924775503

View in Genome Browser
Species Human (GRCh38)
Location 1:247112446-247112468
Sequence GGCCCCGCCGGCCTGAGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 189}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924775494_924775503 13 Left 924775494 1:247112410-247112432 CCAGCGATGAGCAAGGGGGCTGG 0: 1
1: 0
2: 0
3: 21
4: 204
Right 924775503 1:247112446-247112468 GGCCCCGCCGGCCTGAGTCCTGG 0: 1
1: 0
2: 2
3: 22
4: 189
924775487_924775503 28 Left 924775487 1:247112395-247112417 CCTCGCAGGGAGGCCCCAGCGAT 0: 1
1: 0
2: 0
3: 13
4: 112
Right 924775503 1:247112446-247112468 GGCCCCGCCGGCCTGAGTCCTGG 0: 1
1: 0
2: 2
3: 22
4: 189
924775492_924775503 15 Left 924775492 1:247112408-247112430 CCCCAGCGATGAGCAAGGGGGCT 0: 1
1: 0
2: 0
3: 14
4: 94
Right 924775503 1:247112446-247112468 GGCCCCGCCGGCCTGAGTCCTGG 0: 1
1: 0
2: 2
3: 22
4: 189
924775493_924775503 14 Left 924775493 1:247112409-247112431 CCCAGCGATGAGCAAGGGGGCTG 0: 1
1: 0
2: 2
3: 6
4: 120
Right 924775503 1:247112446-247112468 GGCCCCGCCGGCCTGAGTCCTGG 0: 1
1: 0
2: 2
3: 22
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924775503 Original CRISPR GGCCCCGCCGGCCTGAGTCC TGG Intergenic
900096701 1:942766-942788 GGGCTCGCCGGGCAGAGTCCCGG - Exonic
900641904 1:3691590-3691612 GGCCCCTGCAGCCTGAGCCCTGG + Intronic
901506535 1:9689296-9689318 GGCCCCGCCTGGCAGCGTCCTGG + Intronic
901528913 1:9841701-9841723 TGCCCCATCAGCCTGAGTCCTGG - Intergenic
901752244 1:11417498-11417520 GGCCCTGCAGTCCTGAGTCTTGG - Intergenic
901783240 1:11608440-11608462 TGCCCCACCAGCCTGAGTCCTGG + Intergenic
902348624 1:15836993-15837015 CGCCCCGCCGGCCTGAGTGGAGG - Intergenic
903413774 1:23168103-23168125 GGCCGCGCCGGCCCGCGTCCCGG - Intronic
903969398 1:27109100-27109122 GGCTCACCAGGCCTGAGTCCTGG - Intronic
906127054 1:43433118-43433140 GGCCCTGCCTGCCTGACTTCTGG + Exonic
912241285 1:107912512-107912534 GTCCCAGCAGGCCAGAGTCCTGG - Intronic
915130718 1:153693677-153693699 GCCCAGCCCGGCCTGAGTCCAGG - Exonic
915355004 1:155250633-155250655 GGCCCCGCAGGCCACAGTCCAGG + Exonic
915549406 1:156623877-156623899 GGCCACGCTGCCCTGCGTCCTGG + Exonic
917974443 1:180230024-180230046 CGCCCCGCCGGCCTCACTCGGGG + Intergenic
921738556 1:218656798-218656820 AGCCCCTCCAGCCTGAGTCATGG + Intergenic
922821285 1:228487470-228487492 GGCCCCGCCGCCCGCAGCCCTGG + Exonic
923206151 1:231760827-231760849 GGCCCAGGGGGCCTGAGTGCTGG + Intronic
924775503 1:247112446-247112468 GGCCCCGCCGGCCTGAGTCCTGG + Intergenic
1063375829 10:5553712-5553734 GCCCCCGCCGGTCAGTGTCCTGG + Intergenic
1065636916 10:27743186-27743208 GGCCCTGCCCGCCTGCGGCCCGG - Intronic
1065845129 10:29737014-29737036 GGCCCCGCCGGCCTGGCGCGCGG - Intergenic
1066022545 10:31318740-31318762 GTCCCCGCCTGCCTGCTTCCTGG - Intronic
1067295885 10:44975075-44975097 GGCCCCGCCCGCCTGGGGCGCGG + Intronic
1067721552 10:48731492-48731514 GGCCCAGGAGCCCTGAGTCCCGG - Exonic
1069695220 10:70381410-70381432 CCCCCAGCCAGCCTGAGTCCAGG - Intronic
1069960084 10:72074285-72074307 GGCCCCTTCGGCCTTTGTCCAGG - Intronic
1073305691 10:102502085-102502107 GGCCCCACCACCCAGAGTCCCGG + Intronic
1074085897 10:110208799-110208821 GGACACGCCGTCCTGAGCCCGGG + Intronic
1075733417 10:124649701-124649723 GACACCGCCAGCCTGAGTTCTGG - Intronic
1076690955 10:132223707-132223729 GGCCCCACCTGCCTGAGACACGG + Intronic
1077316040 11:1919787-1919809 GGCCCCGTCGGCCCCAGTCCTGG - Intronic
1077556027 11:3226480-3226502 TGCCCAGCAGGCCTGGGTCCAGG - Intergenic
1081812904 11:45923180-45923202 GGCCCTGGCGGCGGGAGTCCTGG + Intronic
1083765683 11:64840394-64840416 GGCGCCTCCTGCCTGAGCCCTGG - Intronic
1083995238 11:66268533-66268555 GGCCTCGCCGCGCTGATTCCCGG - Exonic
1084114006 11:67031339-67031361 GCCACTGCCTGCCTGAGTCCTGG + Intronic
1084165543 11:67373323-67373345 GGCCCCGCCGTGCGGACTCCAGG + Intronic
1088893347 11:114060808-114060830 GGCGCCGCTGGCCAGAGGCCTGG + Intronic
1091390907 12:125641-125663 GCCCCCACCGGCCTGGGTGCAGG - Exonic
1094818081 12:34205638-34205660 AGCCACGCCTGCCTGACTCCAGG - Intergenic
1096368399 12:51047971-51047993 GGCTCCGACGCCCCGAGTCCAGG + Intronic
1098973515 12:76879093-76879115 AGCCCCGCCCGCCGGATTCCCGG + Intergenic
1102000989 12:109558093-109558115 GGCCCAGGGGGCCTGAGTCAGGG - Intronic
1102929178 12:116849494-116849516 GCCCCCGCAGGGCTGGGTCCGGG - Exonic
1103534686 12:121626573-121626595 GGCGCCGCGGGCCTGCGTGCTGG + Exonic
1104354794 12:128075833-128075855 GGCCCAGCCTGCCTGACTCCAGG - Intergenic
1104733056 12:131119500-131119522 GGACCCACAGTCCTGAGTCCCGG + Intronic
1104798135 12:131533885-131533907 GGACCCACAGTCCTGAGTCCAGG - Intergenic
1104937431 12:132374126-132374148 AGCCCCTGAGGCCTGAGTCCTGG + Intergenic
1105702641 13:22944513-22944535 GGCCCTGCTGTCCTGGGTCCTGG + Intergenic
1105855276 13:24366307-24366329 GGCCCTGCTGCCCTGGGTCCTGG + Intergenic
1107058379 13:36130834-36130856 GGGCCCGCTCGCCTGACTCCAGG + Intronic
1110860120 13:80339007-80339029 GCCCCCGCCTGTCTGAGTCTGGG - Exonic
1112077772 13:95931715-95931737 GCGCCCGCCGGCCTGAGTGCAGG + Intronic
1114528469 14:23380622-23380644 GGCCCAGCAGGGCTGACTCCCGG - Intergenic
1118350830 14:64971820-64971842 GGCGCCGGAGGCCGGAGTCCGGG - Intronic
1118350910 14:64972073-64972095 GGCCCCGCTGGCCCCAGTCATGG - Exonic
1118789844 14:69080244-69080266 GCCCCAACCAGCCTGAGTCCAGG - Intronic
1120704789 14:87735039-87735061 CGCCCCGCCGCCCCGAGTGCGGG + Intergenic
1121492677 14:94371401-94371423 GCCCACCCCGGCCTGAGTGCAGG - Intergenic
1122262301 14:100530527-100530549 GGCCCAGCTGGCCACAGTCCTGG - Intergenic
1124533320 15:30524206-30524228 GGCCCCACCAGCCTCTGTCCAGG + Intergenic
1124765337 15:32483439-32483461 GGCCCCACCAGCCTCTGTCCAGG - Intergenic
1127896896 15:63308738-63308760 GGCACCAGCGGCCTGATTCCAGG + Exonic
1128307761 15:66611302-66611324 GGCTCTGTCGGCCTGAGTTCAGG + Intronic
1128866055 15:71115780-71115802 CGCCCCGCCGGCCAGAGAGCGGG - Intronic
1129109354 15:73328699-73328721 GGCCCAGGTGGCCTGACTCCAGG + Intronic
1132527750 16:426015-426037 GGCCCCGCCGGCCTCGCCCCCGG + Exonic
1132623277 16:878371-878393 GGCCCCGGCGGCCAGAGTGAGGG + Intronic
1132880340 16:2159320-2159342 GGCCAAGCCGGCCTCAGACCAGG + Intronic
1132926152 16:2429902-2429924 GGCCCCGCTGGACTGAGGCTCGG - Intronic
1133116665 16:3581519-3581541 GCCACCGCCAGCCTGAGACCAGG - Exonic
1133241318 16:4416149-4416171 GGCCTCGCAGGCCTGGGCCCCGG + Intronic
1134245141 16:12534138-12534160 GGCCGCGCTGCCCTGAGGCCTGG - Intronic
1136075904 16:27817149-27817171 GTACCTGCCGGCCTGATTCCAGG + Intronic
1136453910 16:30369991-30370013 GGCGCGGCCCGCCTGGGTCCCGG - Exonic
1137440979 16:48498305-48498327 GGCCCAGCTGGCTGGAGTCCGGG + Intergenic
1138179234 16:54931050-54931072 GGCGCCGCGGGCCGGAGCCCCGG + Exonic
1139491581 16:67288793-67288815 GGCCCTGCAGGTCTGAGCCCGGG + Exonic
1141841455 16:86576730-86576752 GGCCGCGCCCGCCTAGGTCCTGG - Intronic
1141946590 16:87315025-87315047 GGGGCCGCCTGCCTGTGTCCAGG - Exonic
1142092846 16:88224323-88224345 GGCCCCGCGGTGCTGTGTCCTGG - Intergenic
1142140267 16:88469642-88469664 GGCTCCGCCGGCCTGAGACCTGG + Intronic
1142247958 16:88978411-88978433 GTCCCCTCCAGCCTCAGTCCTGG - Intergenic
1142291892 16:89197047-89197069 GGCCACGCAGGCCTGAAGCCAGG - Intronic
1142417966 16:89953481-89953503 GGCCCTTCCGGCCTGTTTCCTGG + Intronic
1144756130 17:17681680-17681702 GGCCCGGCCGGCCCGCGGCCAGG - Exonic
1146838703 17:36134402-36134424 TGCCCCACTGGCCAGAGTCCTGG - Intergenic
1149444027 17:56699733-56699755 GGCCCCTCCGCCCTGATTGCCGG - Intergenic
1151338583 17:73455552-73455574 AGCGCCACTGGCCTGAGTCCTGG + Intronic
1151725549 17:75881784-75881806 GTCTCTGCCCGCCTGAGTCCTGG - Intronic
1152134083 17:78493894-78493916 GAGCCCTCCGGCCTGAGTCATGG - Intronic
1152363960 17:79844668-79844690 CGCCCCGCCCTCCTGAATCCTGG + Intergenic
1152419580 17:80184877-80184899 TGCCCTCCCCGCCTGAGTCCAGG - Intronic
1152433756 17:80263058-80263080 GACCCCGGAGGCCTGAGTCCTGG + Intronic
1152784287 17:82239952-82239974 GGCCCCGGCGGCCTCTGACCGGG - Exonic
1153040947 18:812417-812439 GGCCACGCCGGCCCGGCTCCGGG + Exonic
1156812904 18:41274079-41274101 GGCCCAGCCTGCCTATGTCCAGG + Intergenic
1160818957 19:1049280-1049302 GCACCGCCCGGCCTGAGTCCTGG + Exonic
1160868491 19:1266570-1266592 GGCCCCGCCCGCCGGACGCCAGG - Intronic
1161224760 19:3138351-3138373 GGCCCCGTTGGCCTAAGCCCGGG + Intronic
1162554142 19:11375875-11375897 GGCCCAGCCCGCCTGGCTCCAGG - Exonic
1162817864 19:13207361-13207383 GGCCCCGCGGGCCGGGCTCCAGG - Exonic
1163158229 19:15450145-15450167 GGCCCGCACGGCCTGAGTCCAGG + Intergenic
1164629832 19:29754865-29754887 GCCCCCACGGGCCTGAGTCCTGG + Intergenic
1164952088 19:32345529-32345551 GGCCCCGCCTACCGGCGTCCCGG - Intergenic
1165152985 19:33771800-33771822 GACCCCTCCGGTCTGAGCCCTGG - Intronic
1165180017 19:33959491-33959513 GGCCCCGCTGGCCTGAGTCTTGG - Intergenic
1166354331 19:42217940-42217962 GGCCCCGGTGGCTTGAGTCACGG - Intronic
925142029 2:1557424-1557446 GGCCCCCACAGCCTGAGTCCTGG - Intergenic
925155681 2:1647636-1647658 GGCCCCACAGGCCTGGGTCTGGG + Intronic
929789851 2:45014256-45014278 AGCCCCGCCGGCCTGAACTCTGG - Intergenic
931036624 2:58251475-58251497 GGCCACGCCAGCCCCAGTCCCGG + Intergenic
931649333 2:64454276-64454298 AGCCCCGTCGGCCCGGGTCCGGG + Exonic
942218071 2:173741962-173741984 GGCCCCACAGGCTTGAGTGCTGG - Intergenic
944221657 2:197310209-197310231 GGCGCCGCCGGCCCGGGCCCCGG - Intronic
947591718 2:231389730-231389752 AGCCCCGCCGCCCTGTGTCCGGG + Intergenic
1168956558 20:1838439-1838461 GGCCCAGCAGGACTGAGGCCTGG - Intergenic
1172367784 20:34363328-34363350 GTCGCCGCCGCCCCGAGTCCCGG + Intronic
1173854969 20:46244387-46244409 TGCCCTGCCTGCCTGGGTCCCGG + Intronic
1174276073 20:49405215-49405237 GGCCACTCCAGCCTGACTCCGGG - Intronic
1174873879 20:54207787-54207809 GGCCCCGCCGCGCTGAGCCTTGG + Intergenic
1175536464 20:59718144-59718166 GCTCCCCCAGGCCTGAGTCCTGG + Intronic
1176194295 20:63830521-63830543 GGTCCCGGCGCCCTGAGGCCGGG - Intronic
1176242195 20:64080212-64080234 GGCCCCGCCGAGCAGAGTCGGGG - Intronic
1176248589 20:64109411-64109433 GGCCACGCTGGCCTGATTCTGGG + Intergenic
1176259704 20:64173144-64173166 GGACTCGCCTGCCTGAATCCTGG - Intronic
1176868670 21:14070810-14070832 GGCCACGCCCGCCTGGCTCCAGG - Intergenic
1178860540 21:36285538-36285560 GGCCCAGCCCCCCTGAGTCCTGG + Intronic
1179725241 21:43338284-43338306 GGCCCCGTCTGCCTGAAGCCTGG - Intergenic
1179882739 21:44300280-44300302 GGCCGGGCCGGCCCGAGACCCGG - Intronic
1179953231 21:44723561-44723583 GGCCCCGCCGGCCTCGCACCCGG - Intergenic
1179963561 21:44786168-44786190 TGCCCCGCTGGCATGAGTGCAGG + Intronic
1180876723 22:19178308-19178330 GGCCGCGCCGACCGAAGTCCGGG - Intronic
1180993625 22:19953654-19953676 TGCCCCGCTGGACTGAGCCCGGG - Intronic
1181007551 22:20021173-20021195 GGCCCGGCCGGCCTGGGCTCGGG + Intronic
1181030517 22:20147137-20147159 TGCCCCGGCGGCCTGGCTCCAGG - Exonic
1181082927 22:20426064-20426086 GGCCCGGCCGGCCCGGGCCCGGG - Exonic
1181610937 22:24011429-24011451 AGCCCCTCCGGCCTGTGCCCCGG - Exonic
1181918354 22:26299005-26299027 TTCCCCGCCGGCCTGACTCTGGG + Exonic
1182524436 22:30906612-30906634 GGGCCAGCCGGCCTGAGTTGTGG - Exonic
1182551850 22:31104925-31104947 GGACCTACCTGCCTGAGTCCTGG - Exonic
1184507499 22:44913345-44913367 GGCCCCTCTGTCCTGAGTCTAGG - Intronic
1184784519 22:46665278-46665300 CGCCCAGCCAGGCTGAGTCCTGG + Intronic
1185021514 22:48379477-48379499 GCTCCCACTGGCCTGAGTCCAGG + Intergenic
1185067452 22:48639274-48639296 GGCCCCGCAGGCCTGAGGGCAGG - Intronic
1185398516 22:50604447-50604469 GGCCCCGCCGGCCGGCGACACGG - Exonic
951543651 3:23806163-23806185 GGCCCCGGCGGCGCGAGTCGGGG - Intronic
953307626 3:41844443-41844465 GGGCCAGCCGGCCTGAGTGCAGG + Intronic
953385327 3:42502823-42502845 CGCCCGGCCGCCCAGAGTCCCGG + Intronic
954138952 3:48595239-48595261 CGCCCCTCCAGCCCGAGTCCTGG + Exonic
954318376 3:49813577-49813599 GGCCCTGCAGGCCTGACACCAGG + Exonic
961646759 3:128396976-128396998 GGCCCCGCAGCCCACAGTCCTGG + Intronic
963741524 3:149086415-149086437 GGCCCCGCAGCCCTGAAGCCGGG + Exonic
966724495 3:183097483-183097505 GGCGAGGACGGCCTGAGTCCAGG - Intronic
968592268 4:1465105-1465127 AGCCCTGCAGGCCTGAGGCCAGG + Intergenic
969712396 4:8851601-8851623 GGCTCTGCGGGCCTGAGGCCAGG + Intronic
973870112 4:55157819-55157841 GGCCCCGCCGGCGTGAGGTGGGG - Intergenic
975683346 4:76897329-76897351 GGCACCGGCGGCCTCTGTCCGGG + Exonic
980358403 4:131742734-131742756 GTCCCCGCAGGCCTGAGGCTGGG - Intergenic
985517238 5:353361-353383 TGCCCCGCCAGCCTGGGGCCAGG + Intronic
987374217 5:17218570-17218592 GGCGCCTCCGCCCTGGGTCCCGG + Intronic
991967801 5:72108739-72108761 GCCCCCGCCAGCCCGAGGCCCGG - Intronic
999305425 5:150516242-150516264 GCCCTCCCCTGCCTGAGTCCTGG + Intronic
999365861 5:151023045-151023067 GCCCCAGCCAGCCAGAGTCCTGG + Intronic
1000212350 5:159119256-159119278 GGGCCCGCCGCTCTGAGTGCGGG - Intergenic
1001586165 5:172834838-172834860 GGCCCCTCCGGACTCATTCCAGG - Intronic
1002067429 5:176658967-176658989 GGCCCCGCTGGCCAGTGTCCTGG + Exonic
1002696900 5:181098109-181098131 GGCCCCGCCGGGCTCAGTTCTGG + Intergenic
1002697722 5:181101264-181101286 GGCCCCGCCGGGCTCAGTTCTGG - Intergenic
1006830380 6:36964590-36964612 TGCCCCTCCCTCCTGAGTCCTGG + Exonic
1007177462 6:39906641-39906663 GGCCCAGCTGGCTGGAGTCCAGG - Exonic
1007400241 6:41599039-41599061 GGCCTCCCCGGTCTGAGTCCTGG - Exonic
1007699809 6:43759882-43759904 GGCTCCCCCAGCCTGACTCCAGG - Intergenic
1013638888 6:112054064-112054086 TGCCCTGCCCTCCTGAGTCCCGG + Exonic
1016590083 6:145735086-145735108 GGCCCCGGCGGCGCGCGTCCCGG - Intronic
1016939756 6:149474324-149474346 GGCCACGCTGGGCAGAGTCCGGG + Exonic
1018864472 6:167736082-167736104 TGCCCTGCCGGCCGGAATCCTGG + Intergenic
1019059253 6:169243322-169243344 GGCCCCGCTGACCTGAGGACTGG - Intronic
1019269635 7:139758-139780 GGCCCCACCGGCCAGTGTCCTGG - Intergenic
1019383333 7:739761-739783 GCCCCTGCCGGCCTGGGACCCGG - Intronic
1019480612 7:1265030-1265052 AGCCCAGCCGGGCTGGGTCCAGG + Intergenic
1019689825 7:2404156-2404178 GGCCCCGCCGACCGCAGCCCTGG + Intronic
1022702976 7:32778644-32778666 GACCCTGCCTGCCTGACTCCAGG - Intergenic
1023360919 7:39414483-39414505 GCCCTCGCCGTCCTGAGGCCTGG + Intronic
1024258357 7:47556462-47556484 GGAGCCTCCGGCCTGAGTCTGGG + Intronic
1029384451 7:100234353-100234375 GACCCTGCTGGCCTCAGTCCTGG + Intronic
1029530475 7:101122059-101122081 GGCCCAGCCTCCCTGATTCCTGG - Intergenic
1032096572 7:128941172-128941194 GGTCCCTCTGGCCTGACTCCAGG + Intronic
1032298854 7:130668545-130668567 AGCCCCGCCGGCCTGAAAGCAGG + Intronic
1033756929 7:144403696-144403718 GGCCGCGGCGGCGGGAGTCCAGG - Intronic
1034162859 7:149005595-149005617 GGCCACGCCTGCCTGGGGCCAGG + Intronic
1035387646 7:158485016-158485038 GGCCCCGGCCGCCAGCGTCCCGG + Intronic
1037977654 8:23224820-23224842 TCCCGCGCCGGCCTGGGTCCTGG + Exonic
1042837735 8:73092999-73093021 GGCGCAGCCGGCCTGGGCCCCGG + Exonic
1044823748 8:96177381-96177403 GGCCAGGCCAGCCTGGGTCCTGG - Intergenic
1045712648 8:105003291-105003313 GGCCCAGAAGGCCTGAGTCTTGG - Intronic
1046770092 8:118110022-118110044 GGCTCTGCCGGCCTTGGTCCAGG - Intronic
1048255579 8:132902756-132902778 GGCCACACCGGTCTGTGTCCTGG - Intronic
1049167554 8:141136076-141136098 AGCCCCGCTGGGCTGAGTACCGG + Intronic
1049409458 8:142465986-142466008 GGCCCCGTGGGCCTCAGTGCAGG + Intronic
1049529364 8:143146785-143146807 GGCCCCTCTAGCCTGAGCCCTGG + Intergenic
1056844037 9:90022162-90022184 TGCCTAGCTGGCCTGAGTCCTGG + Intergenic
1057361201 9:94374943-94374965 GGGCCCGGCTGCCTGAATCCCGG + Intronic
1057662161 9:97013221-97013243 GGGCCCGGCGGCCTGAATGCCGG - Intronic
1060935107 9:127510062-127510084 GGCCCCGGCTGCGTGACTCCGGG - Intronic
1061457879 9:130712596-130712618 GGCCCCGCCCTCCTGGGACCTGG - Intergenic
1061882897 9:133576924-133576946 GGCCCCGCCGGGCAGAGCCCTGG + Intergenic
1062273314 9:135719567-135719589 GGCCCCGGTGGGCTGGGTCCTGG - Intronic
1190059050 X:47199257-47199279 GGCCCCGCAGGCCTGATACCAGG - Exonic
1190885815 X:54530195-54530217 GGCGCCGCCGGCCTGGGATCCGG + Exonic
1193743216 X:85243814-85243836 GACCCCGCCGGCTTGAGGCGGGG - Intergenic
1199426554 X:147708516-147708538 GGCCCCACCCTCCTGAGCCCTGG + Intergenic