ID: 924783310

View in Genome Browser
Species Human (GRCh38)
Location 1:247171777-247171799
Sequence CCCGGGCCCCGGGCTCCCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 2, 1: 0, 2: 2, 3: 51, 4: 420}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924783310_924783323 15 Left 924783310 1:247171777-247171799 CCGCTGGGAGCCCGGGGCCCGGG 0: 2
1: 0
2: 2
3: 51
4: 420
Right 924783323 1:247171815-247171837 TCCCTTCTCCAGACCCCCGGCGG 0: 2
1: 0
2: 0
3: 17
4: 220
924783310_924783322 12 Left 924783310 1:247171777-247171799 CCGCTGGGAGCCCGGGGCCCGGG 0: 2
1: 0
2: 2
3: 51
4: 420
Right 924783322 1:247171812-247171834 CCTTCCCTTCTCCAGACCCCCGG 0: 2
1: 0
2: 5
3: 74
4: 573

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924783310 Original CRISPR CCCGGGCCCCGGGCTCCCAG CGG (reversed) Intronic