ID: 924783405

View in Genome Browser
Species Human (GRCh38)
Location 1:247172143-247172165
Sequence CTCCCGCGCGTGTCTGAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 2, 1: 0, 2: 0, 3: 3, 4: 33}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924783399_924783405 10 Left 924783399 1:247172110-247172132 CCGCCCCCTCAGACTCTTAGTGA 0: 2
1: 0
2: 1
3: 13
4: 158
Right 924783405 1:247172143-247172165 CTCCCGCGCGTGTCTGAATGAGG 0: 2
1: 0
2: 0
3: 3
4: 33
924783397_924783405 12 Left 924783397 1:247172108-247172130 CCCCGCCCCCTCAGACTCTTAGT 0: 2
1: 0
2: 1
3: 12
4: 143
Right 924783405 1:247172143-247172165 CTCCCGCGCGTGTCTGAATGAGG 0: 2
1: 0
2: 0
3: 3
4: 33
924783404_924783405 4 Left 924783404 1:247172116-247172138 CCTCAGACTCTTAGTGACAGGTG 0: 2
1: 0
2: 0
3: 13
4: 186
Right 924783405 1:247172143-247172165 CTCCCGCGCGTGTCTGAATGAGG 0: 2
1: 0
2: 0
3: 3
4: 33
924783403_924783405 5 Left 924783403 1:247172115-247172137 CCCTCAGACTCTTAGTGACAGGT 0: 2
1: 0
2: 0
3: 12
4: 94
Right 924783405 1:247172143-247172165 CTCCCGCGCGTGTCTGAATGAGG 0: 2
1: 0
2: 0
3: 3
4: 33
924783398_924783405 11 Left 924783398 1:247172109-247172131 CCCGCCCCCTCAGACTCTTAGTG 0: 2
1: 0
2: 1
3: 21
4: 261
Right 924783405 1:247172143-247172165 CTCCCGCGCGTGTCTGAATGAGG 0: 2
1: 0
2: 0
3: 3
4: 33
924783401_924783405 6 Left 924783401 1:247172114-247172136 CCCCTCAGACTCTTAGTGACAGG 0: 2
1: 0
2: 2
3: 11
4: 128
Right 924783405 1:247172143-247172165 CTCCCGCGCGTGTCTGAATGAGG 0: 2
1: 0
2: 0
3: 3
4: 33
924783396_924783405 19 Left 924783396 1:247172101-247172123 CCTCAGGCCCCGCCCCCTCAGAC 0: 2
1: 0
2: 12
3: 89
4: 1247
Right 924783405 1:247172143-247172165 CTCCCGCGCGTGTCTGAATGAGG 0: 2
1: 0
2: 0
3: 3
4: 33
924783400_924783405 7 Left 924783400 1:247172113-247172135 CCCCCTCAGACTCTTAGTGACAG 0: 2
1: 0
2: 2
3: 17
4: 183
Right 924783405 1:247172143-247172165 CTCCCGCGCGTGTCTGAATGAGG 0: 2
1: 0
2: 0
3: 3
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924783405 Original CRISPR CTCCCGCGCGTGTCTGAATG AGG Intergenic