ID: 924783575

View in Genome Browser
Species Human (GRCh38)
Location 1:247173584-247173606
Sequence TTGTTATTATGGAGATGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 220}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924783572_924783575 -1 Left 924783572 1:247173562-247173584 CCTCTAGCAGGCTAACATGGACT 0: 1
1: 0
2: 6
3: 10
4: 91
Right 924783575 1:247173584-247173606 TTGTTATTATGGAGATGACAGGG 0: 1
1: 0
2: 1
3: 31
4: 220
924783568_924783575 15 Left 924783568 1:247173546-247173568 CCCTATAGTATCTCATCCTCTAG 0: 1
1: 0
2: 2
3: 28
4: 190
Right 924783575 1:247173584-247173606 TTGTTATTATGGAGATGACAGGG 0: 1
1: 0
2: 1
3: 31
4: 220
924783567_924783575 18 Left 924783567 1:247173543-247173565 CCTCCCTATAGTATCTCATCCTC 0: 1
1: 0
2: 1
3: 15
4: 133
Right 924783575 1:247173584-247173606 TTGTTATTATGGAGATGACAGGG 0: 1
1: 0
2: 1
3: 31
4: 220
924783569_924783575 14 Left 924783569 1:247173547-247173569 CCTATAGTATCTCATCCTCTAGC 0: 1
1: 0
2: 1
3: 16
4: 107
Right 924783575 1:247173584-247173606 TTGTTATTATGGAGATGACAGGG 0: 1
1: 0
2: 1
3: 31
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924783575 Original CRISPR TTGTTATTATGGAGATGACA GGG Intergenic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
903854705 1:26330091-26330113 TTGTTATCATGAAGATGAAAAGG - Intronic
904879262 1:33682567-33682589 TTGGTATTATGGAAAAGAAAAGG + Intronic
905334250 1:37233227-37233249 ATGTCCTTAGGGAGATGACATGG - Intergenic
905366709 1:37455539-37455561 TTTTTATTATGAAGCTGCCAAGG - Intergenic
905512326 1:38531340-38531362 TTGTTATTGTGAAGAAGACTAGG + Intergenic
905562786 1:38940732-38940754 ATATTTTTATGAAGATGACAGGG - Intronic
905623020 1:39465309-39465331 TTTTTATAAAGGAGATGAAATGG + Intronic
906936625 1:50219465-50219487 TTGTTATCCTGCAGATGAGATGG + Intergenic
907574552 1:55514346-55514368 TTGTTATAAAGGAGAAGACAAGG - Intergenic
909291750 1:73891396-73891418 TTATTATAATGGAAATGAGAAGG + Intergenic
910558901 1:88568512-88568534 TTTTTTTTGTGGAGATGATAGGG - Intergenic
910785462 1:90993205-90993227 TTGTTATCATGGTGGTGGCAAGG - Intronic
911018310 1:93358752-93358774 TTGTTATTAGGGAGCTGAAAAGG - Intronic
913344835 1:117797786-117797808 TTGTTATCATGTAAATGACATGG + Intergenic
914870004 1:151465345-151465367 TTGTTGCTATGGAGTTGACCAGG + Intergenic
915397100 1:155593517-155593539 GTGTTATGATGGGGAAGACAAGG - Intergenic
917117626 1:171618434-171618456 TTGCTGTTGTGGGGATGACAAGG + Intergenic
918522816 1:185433159-185433181 TTGTTTCTATGGAGATGAGCAGG + Intergenic
919081456 1:192871542-192871564 TAGTAATTTTGGAGATGATATGG + Intergenic
919947759 1:202333641-202333663 TTGGTATTATAGAAATGTCAGGG + Intronic
920939963 1:210472959-210472981 TTCTTATTATGTAGATGAAGTGG + Intronic
923795259 1:237148090-237148112 ATATTATGGTGGAGATGACATGG + Intronic
924103790 1:240630861-240630883 CTGTTAGTATGAAGCTGACATGG + Intergenic
924233641 1:241982714-241982736 TTGTTTATATGCAGATAACAAGG - Intergenic
924783575 1:247173584-247173606 TTGTTATTATGGAGATGACAGGG + Intergenic
1062883328 10:996327-996349 CTTGTATTTTGGAGATGACAGGG + Intronic
1063572816 10:7231904-7231926 ATGGTATAATAGAGATGACAGGG + Intronic
1065385640 10:25130704-25130726 TTCTTATCATGGAGATGTCAGGG - Intergenic
1069136036 10:64766998-64767020 TTGTTATTAAGGACTTGACAGGG - Intergenic
1069277606 10:66612120-66612142 TTGTGATGATGGAGGTGAAAGGG - Intronic
1071751142 10:88477520-88477542 TTGTGATGATGGTGAAGACAGGG + Intronic
1072220678 10:93325186-93325208 TTGTTATAATGAAGATGTCCAGG - Intronic
1073866791 10:107813918-107813940 TTCTTTTCATGGAGAAGACATGG - Intergenic
1075119671 10:119655214-119655236 GTGTGAATATGGGGATGACATGG + Intronic
1075368208 10:121912062-121912084 TTGTAATTTTAGAGAAGACAGGG + Intronic
1075875770 10:125804417-125804439 TTTTTATAAAGGAGATAACAAGG - Intronic
1075960724 10:126565948-126565970 TTGTGAATATGGAAATGATAAGG - Intronic
1076755499 10:132569290-132569312 CTGTTAATATGAAGCTGACATGG + Intronic
1078282309 11:9915072-9915094 TTGTGAAGATGGAGATGAAATGG + Intronic
1079359003 11:19754754-19754776 TGGTTATTTTGTAGAGGACATGG + Intronic
1079651812 11:22939223-22939245 TAGTTGTTCAGGAGATGACAGGG - Intergenic
1081889246 11:46526503-46526525 TTCTTGTTATATAGATGACAGGG - Intronic
1085971325 11:81594786-81594808 ATGTTATTGTGTAGATGAAATGG + Intergenic
1086812844 11:91332239-91332261 TTTTTATTATGGAGTTGTAATGG - Intergenic
1087065787 11:94026747-94026769 TTGGTCTTAGGGAGATGCCAAGG + Intronic
1090712828 11:129403302-129403324 TTTTTATCATGGGGATGAGATGG + Intronic
1093151946 12:15632209-15632231 TTGTTAAAATGGAAATGTCACGG + Intronic
1093415845 12:18919698-18919720 TTGTTATTAGAGAAATGGCAAGG - Intergenic
1095044334 12:37483998-37484020 ATGCTATTTTGGAGATGGCATGG - Intergenic
1099142970 12:79002753-79002775 TTGTTGTTAAGGAGATGAGGAGG + Intronic
1099159597 12:79224409-79224431 TTGTTATTTTGGGGATGACCAGG + Intronic
1101626631 12:106449591-106449613 ATGTTATTAAGGAAATGATAAGG + Intronic
1103796195 12:123504838-123504860 TTGGTATCATGGAGAAGACACGG - Intronic
1105510204 13:21045386-21045408 CTGTTCTTGTGGAGATGAAAAGG - Intronic
1105537192 13:21278229-21278251 TTCTCATTATGTATATGACACGG + Intergenic
1105862396 13:24427378-24427400 TTTTTTTTTTGGAGAAGACAGGG + Intronic
1105910535 13:24861361-24861383 GTGGTATTATGGAGCTGACAAGG - Exonic
1106802655 13:33271874-33271896 GTATAATTATGAAGATGACAGGG + Intronic
1109184786 13:59254975-59254997 ATGTTATCCTGGAGATGACTGGG - Intergenic
1110414647 13:75238549-75238571 CTGTTCCCATGGAGATGACAGGG + Intergenic
1110902705 13:80843480-80843502 TTGGCATTATGAAGATGAAAGGG + Intergenic
1112511612 13:100014565-100014587 TTGTTTCTATTGAGATGAAAAGG - Intergenic
1112555483 13:100464366-100464388 CTGCTTTTATGGAGATGGCAAGG + Intronic
1114728417 14:24964274-24964296 GTGCTATTACAGAGATGACATGG + Intronic
1114997217 14:28369739-28369761 TTTTTATTATGGTGATCAAAAGG - Intergenic
1116346760 14:43803547-43803569 TTGTTCTGATGGAGGTGACAGGG - Intergenic
1116754159 14:48925190-48925212 TTGTGATGATGGAAATGAGATGG + Intergenic
1120232952 14:81859480-81859502 GGGTTATTATGAAGATTACATGG + Intergenic
1121423847 14:93834258-93834280 TGGTTATTGTGAAGATGAAATGG - Intergenic
1121910593 14:97788905-97788927 GTGTCATTATGAAGATTACATGG - Intergenic
1202942886 14_KI270725v1_random:171682-171704 ATGCTATTTTGGAGATGGCATGG - Intergenic
1125155618 15:36581356-36581378 TACTTATTATAGAGAAGACAAGG - Intronic
1125935679 15:43633526-43633548 TTGTTAATAGGCAGATGAAACGG - Intronic
1126730740 15:51680087-51680109 CTGTTATTATGAAGATCAAATGG - Intergenic
1129260233 15:74362511-74362533 TTGTTATAGTGTAGATGGCAAGG - Intronic
1130942190 15:88520196-88520218 TTGTTATTTTTTAGATGAGAGGG - Intronic
1131368310 15:91858324-91858346 TAGTAATTATGGAAATGGCAAGG - Intronic
1132759957 16:1503957-1503979 TTCTTCTGGTGGAGATGACAGGG - Intronic
1133840232 16:9401535-9401557 TGGTGATGATGGAGGTGACAAGG - Intergenic
1135850403 16:25958193-25958215 TTGTTATAAGGCAGATGCCATGG + Intronic
1136654037 16:31699021-31699043 TTGTTCTCATGGAGATGGCAGGG - Intergenic
1137250845 16:46739639-46739661 ATGTTATTACGGTGATCACAAGG - Intronic
1139295043 16:65893346-65893368 ATGTCAATATTGAGATGACAGGG - Intergenic
1140997990 16:80279635-80279657 TTGTAAAGATGGAGAAGACAGGG + Intergenic
1142064436 16:88053055-88053077 TGATAATGATGGAGATGACAGGG - Intronic
1144995846 17:19267925-19267947 TTGTTACTATTGAGAAGAGATGG + Intronic
1147594641 17:41709019-41709041 TTGTTATCGTTGTGATGACAGGG + Intergenic
1150244237 17:63662096-63662118 TTATTATTATTGAGATGAGATGG - Intronic
1150887577 17:69105286-69105308 CTCTGATTTTGGAGATGACAGGG - Intronic
1152142813 17:78548178-78548200 TTGTTATTTCGTAGATGTCATGG + Intronic
1155544061 18:26896790-26896812 TTGTTATCCTGGAAATGACAGGG - Intergenic
1158886444 18:61831494-61831516 TTCTTATTATGGAGATAATAAGG - Intronic
1159679109 18:71325482-71325504 TTGTGATTATGAAGGTGACGTGG + Intergenic
1160431365 18:78815030-78815052 TTGTTATTATTGTGATGCCACGG - Intergenic
1164914158 19:32037141-32037163 TTGTTAATTTGGAGAGGACATGG + Intergenic
1165784609 19:38453545-38453567 CTGTCCTTATGGAGTTGACATGG + Intronic
1165937912 19:39400617-39400639 TTATTATTAAATAGATGACAAGG + Exonic
1168330059 19:55562966-55562988 TTATTATTTTAGAGATGGCAGGG + Intergenic
925238740 2:2302858-2302880 TTGTTATAATGAAGAAGCCAAGG + Intronic
927174866 2:20398760-20398782 TTATCATTATGGAGATTCCAAGG + Intergenic
929029411 2:37636589-37636611 TTGTTGTTATCTGGATGACAGGG + Intergenic
929240539 2:39648911-39648933 TTGTTATTAAAGTGATGACAAGG - Intergenic
931078697 2:58744778-58744800 TTGTCTTCATGGAGATCACATGG - Intergenic
933091585 2:78125989-78126011 TTGGTATCATGTAGAGGACAAGG + Intergenic
933294572 2:80474436-80474458 TTGTTGTTTTGGGGATGAGATGG - Intronic
934049041 2:88194874-88194896 TTTTTGTCAGGGAGATGACAAGG + Intergenic
934050471 2:88206300-88206322 TTCTTATTCTGGAGATTCCAAGG - Intergenic
935185335 2:100726667-100726689 TTGTTATCATGCAGATTCCAGGG - Intergenic
935416610 2:102825903-102825925 TTGGTATCATGGAGAGAACATGG - Intronic
937141066 2:119600923-119600945 ATGTCATTATGGAAATGATAAGG - Intronic
937309405 2:120892859-120892881 GGTTTATTTTGGAGATGACAGGG - Intronic
938176736 2:129140126-129140148 ATGTTATTATGGACATGAAGGGG + Intergenic
939882117 2:147642544-147642566 AGGTTATTCTGGAGATGAGAGGG - Intergenic
941375902 2:164730489-164730511 TTGTTATTATTATTATGACAGGG - Intronic
945051903 2:205831956-205831978 TTGCTCATATGGTGATGACAGGG + Intergenic
945196511 2:207242179-207242201 TGGTTATTAAGGGGAAGACATGG + Intergenic
945586311 2:211668351-211668373 TCTTTATTATGGAAATGAGATGG - Intronic
945977714 2:216283588-216283610 TTGTGCTTATGGCGATGACGTGG + Exonic
947218694 2:227772286-227772308 TTGTGATTCTGGAGATCTCAAGG - Intergenic
947609308 2:231513652-231513674 TTATTATTAGGCACATGACAAGG + Intergenic
1173058233 20:39636662-39636684 TTCTCATTCTGCAGATGACAGGG + Intergenic
1173160647 20:40649696-40649718 TGGTTGTTGGGGAGATGACATGG + Intergenic
1174182209 20:48681979-48682001 TTTTGAATATGGAAATGACATGG - Intronic
1175844639 20:62051996-62052018 TTGTGGTTGTGGAGGTGACATGG - Intronic
1176863183 21:14025647-14025669 TTGTTCTCATGGAGATGGAAGGG - Intergenic
1177722189 21:24921585-24921607 TTGTTATAAGGGAGAGGAAATGG - Intergenic
1180590408 22:16932458-16932480 TTGTAATTATGGTGCTCACATGG - Intergenic
1181554071 22:23657536-23657558 TTGTTTTTTTTGAGATGAGATGG + Intergenic
949861259 3:8506889-8506911 TTGTTATTTGGGAGATGATCTGG - Intronic
951336626 3:21430719-21430741 TTGTTTTTAAGGAGAAGAAATGG - Intronic
951678429 3:25268530-25268552 TTGTTATCATGGAGAATTCAAGG + Intronic
951715703 3:25643365-25643387 TCTTGAATATGGAGATGACAGGG - Intronic
951770183 3:26246556-26246578 TTGTTATGATGGGGATGATTGGG + Intergenic
953330019 3:42044746-42044768 TTGTTATTAAGAAGATTTCATGG + Intronic
953584270 3:44185645-44185667 TTTTTATTACGTAGATGACATGG + Intergenic
953937111 3:47055190-47055212 TTGTTAAAATGGCCATGACAAGG - Intronic
955815900 3:62842518-62842540 TTGTTAATATGGTGATTAAATGG - Intronic
957514644 3:81234523-81234545 TTTTTATTTTGCAGATCACATGG + Intergenic
957953878 3:87159311-87159333 TTGTGATTATGGACATAACAAGG - Intergenic
960465039 3:117987594-117987616 ATGTTATTAAGAAGATGATAAGG - Intergenic
960578016 3:119246163-119246185 TTGTTCTGATGGAGGTGGCAGGG - Intergenic
960871747 3:122256919-122256941 CTGTTAAAATGGGGATGACATGG - Intronic
961322377 3:126084423-126084445 GTTTTATTATGGAGCTGTCAAGG + Intronic
962074242 3:132064002-132064024 TTGTTATTATGGTTATGTCTTGG - Intronic
962099906 3:132330849-132330871 TTGTTAAAATGCAGATGTCAGGG + Intronic
965897642 3:173596694-173596716 ATGTTAATATGGTCATGACATGG + Intronic
966242736 3:177772878-177772900 TTGTTACCATGAAGATCACAGGG - Intergenic
966779046 3:183567820-183567842 TTGTAATTCTGGAGGTGAGATGG - Intergenic
967693710 3:192506785-192506807 TTGTTAAAATGGAGATCATACGG - Intronic
968383954 4:120256-120278 TTGTTCTAATAGAGATGAAAGGG - Intergenic
971350685 4:25853232-25853254 TTTTTATTTTGGAGGGGACAGGG - Intronic
971680242 4:29690084-29690106 TTGTTATTATTGAAATAATATGG - Intergenic
971960463 4:33480066-33480088 TTCATATTCAGGAGATGACAAGG - Intergenic
972038961 4:34566093-34566115 TTGTTGTTATGGAGATAAAAAGG - Intergenic
972447330 4:39157607-39157629 TTGGTATTTTGGGGATGACACGG + Intergenic
974725008 4:65787328-65787350 TTATTATTAAGGATATGACAAGG + Intergenic
975251856 4:72189402-72189424 ATTTTATTATTGAGATAACAAGG + Intergenic
975667400 4:76746159-76746181 TTTTTATTCAGGAGATGGCATGG - Intronic
978545303 4:109865791-109865813 TTGTTATTATAGATATCTCATGG + Intronic
978670232 4:111239423-111239445 ATGTTATTATGGAAATCACATGG - Intergenic
979514233 4:121588544-121588566 ATGTAAATATGGAGATGATATGG + Intergenic
979729283 4:124004196-124004218 TGGTTACTATGGATATTACAAGG + Intergenic
980240484 4:130167641-130167663 TACTTATTTTGGAGATGACATGG - Intergenic
981920981 4:150084475-150084497 TTGTTTTTAAGGAAATGAGATGG - Intronic
982988092 4:162235462-162235484 TGGTTGTTATGGCGATGAAAAGG + Intergenic
983035918 4:162865417-162865439 TTGTTCTGGTGGAGATGGCAAGG - Intergenic
983636806 4:169905958-169905980 TTGATATTCTGGAGATGTGATGG + Intergenic
984401274 4:179268224-179268246 TTGTTATAATGGATACTACAGGG + Intergenic
986836101 5:11639118-11639140 TTGTTACAATGGGGATGAGAAGG + Intronic
987468705 5:18304175-18304197 TTTTTATTAGGGAGACCACAAGG + Intergenic
987541946 5:19267261-19267283 TTTTCATTATTGAGATTACAGGG + Intergenic
988243440 5:28644528-28644550 TTCTTAATATGGACATGATAAGG - Intergenic
989125294 5:38046924-38046946 TGGTTATTAGGAAGATGACAAGG + Intergenic
989649880 5:43675844-43675866 TTAATATTTTGGAGATCACATGG + Intronic
989985641 5:50694308-50694330 TTGTGACTATGGAACTGACAAGG - Intronic
991620842 5:68544063-68544085 ATGATATTGGGGAGATGACATGG + Intergenic
992270596 5:75059057-75059079 TTGTTATTATGAAGATTATATGG - Intergenic
996789531 5:127277858-127277880 TTGCTGAGATGGAGATGACAAGG + Intergenic
998661566 5:144244593-144244615 TTGTTAATATGGAGATATAATGG - Intronic
999458286 5:151736346-151736368 TTTTTTTTATGGAGATGATGGGG - Intergenic
999861355 5:155650204-155650226 TAATTATTATAGAGATAACAAGG + Intergenic
1003316236 6:5014507-5014529 TTGTTTTCATGGAGATGGCGGGG + Intergenic
1003321140 6:5053085-5053107 TTGTTGTTTTGGATATGAAATGG + Intergenic
1004061603 6:12203531-12203553 TTATTATTATAGAGGTGACATGG + Intergenic
1007732860 6:43959971-43959993 ATGTTATTATGAAAATCACAAGG - Intergenic
1007952344 6:45883647-45883669 TTCTAATTATGGAGAAGACCAGG + Intergenic
1008414407 6:51223141-51223163 TTATTACTATTGAGATGGCATGG + Intergenic
1009449507 6:63784803-63784825 TTATTATTCTAGAGTTGACAGGG + Intronic
1009530498 6:64807380-64807402 TAGTTATTATATAGGTGACAAGG - Intronic
1010418149 6:75639042-75639064 TTTTTGTTTTTGAGATGACAGGG - Intronic
1012737882 6:102973995-102974017 TTGTTCTGGTGGAGATGGCAGGG - Intergenic
1014141252 6:117945761-117945783 TTGTTACTATGCAGAAGAAAAGG - Intronic
1014206537 6:118662205-118662227 ATGTTGTTATGAAGATGAAATGG - Intronic
1015055045 6:128890914-128890936 ATGTTTTTATGAAGATGTCAAGG - Intronic
1015738636 6:136428850-136428872 ATGTTATTCTGGAGATTATAAGG - Intronic
1016023577 6:139260987-139261009 TTGCTCTGGTGGAGATGACAAGG + Intronic
1018545082 6:164926878-164926900 ATGTTAGTATAGAAATGACAGGG + Intergenic
1018548517 6:164964630-164964652 TTGTTATAATGAAGCTGCCATGG + Intergenic
1022457804 7:30574230-30574252 TTAAAATTATGGAAATGACAAGG - Intergenic
1025290258 7:57713544-57713566 ATGCTATTTTGGAGATGGCATGG - Intergenic
1026514465 7:71056491-71056513 TTGTTATTATGTGGGTGAAAGGG - Intergenic
1026571180 7:71532503-71532525 CAGTTCTTAGGGAGATGACACGG + Intronic
1027635019 7:80660813-80660835 TTGTTATAATGGAGACTCCATGG - Intronic
1027738172 7:81962400-81962422 TTATTGTTATGGCAATGACAAGG + Intronic
1029931669 7:104377822-104377844 TTATTATTATTGAGAATACATGG - Intronic
1030910084 7:115236476-115236498 TAGCTCTTATGGAGCTGACATGG + Intergenic
1030942164 7:115666303-115666325 TTGTTTTGATGGAGAAAACATGG + Intergenic
1031089677 7:117339531-117339553 TTGTTATTTTATAGATGACATGG + Intergenic
1031495130 7:122437282-122437304 TGGTTGTTATGGTGATGAGATGG + Intronic
1031860716 7:126976857-126976879 GTTTTACTATAGAGATGACAGGG + Intronic
1033007585 7:137584242-137584264 TTGTTAAAATGCAGATTACAAGG - Intronic
1034754100 7:153598391-153598413 TTGTTAGAATGGAGATGTCTGGG + Intergenic
1035112329 7:156493418-156493440 TAGTGAATATGGAGTTGACATGG - Intergenic
1036186318 8:6625406-6625428 TTGTTATAATGGAAATGAACGGG - Intronic
1037806090 8:22058599-22058621 TTGTTGTTATTGAGAGAACAAGG + Intronic
1042432031 8:68717851-68717873 CTATTATAATGGTGATGACATGG + Intronic
1045717215 8:105061993-105062015 TTTATATTATAAAGATGACATGG + Intronic
1046828042 8:118713535-118713557 TTTTTATTATTGAGAAAACATGG - Intergenic
1046975995 8:120278367-120278389 TTGTTTTTCTGGAGAAGAAAGGG - Intronic
1048574986 8:135683246-135683268 TTGTTATAATGCAGATTCCAGGG + Intergenic
1048700612 8:137084592-137084614 TTCTTATTATGCAGCTGTCAAGG + Intergenic
1049132207 8:140856344-140856366 TTACTATTATTGAGATGACTGGG - Intronic
1050023069 9:1305123-1305145 TTGGTAGTATGCAAATGACAGGG + Intergenic
1051126586 9:13812151-13812173 AAGACATTATGGAGATGACATGG + Intergenic
1052602041 9:30646522-30646544 TTTTTATTATGGATTTGAAAAGG + Intergenic
1053247870 9:36550002-36550024 TTGTATTTATGGAGGAGACAGGG + Intergenic
1054166169 9:61731827-61731849 ATGCTATTTTGGAGATGGCATGG + Intergenic
1055882871 9:81022994-81023016 TAGTTGTAATGGAGATGGCATGG - Intergenic
1058643656 9:107110540-107110562 TTGTTATTATGAAATTGACTGGG + Intergenic
1059686430 9:116641560-116641582 TTGTTATTATTAAAAGGACAAGG + Intronic
1059784226 9:117563215-117563237 TTGTTATCAAGGAGCTCACAAGG + Intergenic
1060185932 9:121564232-121564254 TAGTTATTGTGCAGATGAAATGG - Intergenic
1060284262 9:122234936-122234958 TTGTCAGCATGGAGATGACATGG + Intergenic
1061069769 9:128302089-128302111 TTGTTTATTTAGAGATGACAGGG + Intergenic
1061115660 9:128609736-128609758 TTGTTATTATTGTGGTCACACGG + Intronic
1062571360 9:137187031-137187053 TTGTTAGTTTGGAGAGGAGAGGG - Intronic
1186012630 X:5152177-5152199 TTGTTATTTTGTAGATAACTTGG - Intergenic
1187141223 X:16595857-16595879 TTTTTTTTAAGGAAATGACAAGG - Intronic
1187287764 X:17922532-17922554 TTGTAACTATGGAGATAAGAGGG + Intergenic
1187824821 X:23324363-23324385 TTTTTATTCTGGAGATGACAGGG - Intergenic
1188042689 X:25388113-25388135 TTATCATACTGGAGATGACATGG - Intergenic
1188646125 X:32569470-32569492 TTGTTAGAATGCAGATGACTAGG + Intronic
1188790992 X:34408233-34408255 TCATTACTATGGAGATTACAAGG - Intergenic
1191803435 X:65106372-65106394 TTGTAAATATGGACATGACTTGG + Intergenic
1193626570 X:83829186-83829208 TTGTTTTTATGCAGATGACTTGG + Intergenic
1195799785 X:108695000-108695022 TTCTTATTATGCAAATGACAGGG - Intronic
1197125540 X:122941676-122941698 GGGTTACTATGGAGCTGACATGG + Intergenic
1197752927 X:129978068-129978090 TTATTATTATGGTTATGTCATGG + Intergenic
1199149240 X:144409933-144409955 TTCTAATTAAAGAGATGACATGG + Intergenic
1200533248 Y:4361280-4361302 TTATTATCATGGAAATGAAATGG + Intergenic
1201423825 Y:13828105-13828127 TCGTTATTTTGGAGAAGAAAAGG - Intergenic
1201665959 Y:16454625-16454647 TTGTTATTTTGTAGATAATATGG + Intergenic