ID: 924788096

View in Genome Browser
Species Human (GRCh38)
Location 1:247219094-247219116
Sequence CAACCCTCGAACCAGGGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924788088_924788096 20 Left 924788088 1:247219051-247219073 CCCTGGATAGTCCTTTGGGGAGA No data
Right 924788096 1:247219094-247219116 CAACCCTCGAACCAGGGACAAGG No data
924788091_924788096 9 Left 924788091 1:247219062-247219084 CCTTTGGGGAGATTGTTGCAGGT No data
Right 924788096 1:247219094-247219116 CAACCCTCGAACCAGGGACAAGG No data
924788087_924788096 21 Left 924788087 1:247219050-247219072 CCCCTGGATAGTCCTTTGGGGAG No data
Right 924788096 1:247219094-247219116 CAACCCTCGAACCAGGGACAAGG No data
924788089_924788096 19 Left 924788089 1:247219052-247219074 CCTGGATAGTCCTTTGGGGAGAT No data
Right 924788096 1:247219094-247219116 CAACCCTCGAACCAGGGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924788096 Original CRISPR CAACCCTCGAACCAGGGACA AGG Intergenic
No off target data available for this crispr