ID: 924788757

View in Genome Browser
Species Human (GRCh38)
Location 1:247223643-247223665
Sequence AAACCATGCTTCATAAATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924788754_924788757 -3 Left 924788754 1:247223623-247223645 CCAGAATTTCATATCCAGCCAAA 0: 7000
1: 2915
2: 1076
3: 612
4: 742
Right 924788757 1:247223643-247223665 AAACCATGCTTCATAAATAAAGG No data
924788753_924788757 -2 Left 924788753 1:247223622-247223644 CCCAGAATTTCATATCCAGCCAA 0: 6865
1: 3039
2: 1544
3: 1492
4: 2403
Right 924788757 1:247223643-247223665 AAACCATGCTTCATAAATAAAGG No data
924788752_924788757 2 Left 924788752 1:247223618-247223640 CCAACCCAGAATTTCATATCCAG 0: 117
1: 201
2: 429
3: 612
4: 931
Right 924788757 1:247223643-247223665 AAACCATGCTTCATAAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924788757 Original CRISPR AAACCATGCTTCATAAATAA AGG Intergenic
No off target data available for this crispr