ID: 924791457

View in Genome Browser
Species Human (GRCh38)
Location 1:247253734-247253756
Sequence TGCGCCCGAGGTTAGTGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924791457_924791461 -10 Left 924791457 1:247253734-247253756 CCCTTTCACTAACCTCGGGCGCA No data
Right 924791461 1:247253747-247253769 CTCGGGCGCAAACAAAGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924791457 Original CRISPR TGCGCCCGAGGTTAGTGAAA GGG (reversed) Intergenic
No off target data available for this crispr