ID: 924792478

View in Genome Browser
Species Human (GRCh38)
Location 1:247265764-247265786
Sequence GTGAGCCAAGCTCATACTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924792478_924792480 -3 Left 924792478 1:247265764-247265786 CCAGTAGTATGAGCTTGGCTCAC No data
Right 924792480 1:247265784-247265806 CACTGCAACATCTGCCTCCTGGG 0: 404
1: 30441
2: 103566
3: 163452
4: 190543
924792478_924792479 -4 Left 924792478 1:247265764-247265786 CCAGTAGTATGAGCTTGGCTCAC No data
Right 924792479 1:247265783-247265805 TCACTGCAACATCTGCCTCCTGG 0: 665
1: 52373
2: 103209
3: 141772
4: 104864

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924792478 Original CRISPR GTGAGCCAAGCTCATACTAC TGG (reversed) Intergenic
No off target data available for this crispr