ID: 924792583

View in Genome Browser
Species Human (GRCh38)
Location 1:247266459-247266481
Sequence CCCAGTGGGCACCCCAATTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924792583_924792593 9 Left 924792583 1:247266459-247266481 CCGGAATTGGGGTGCCCACTGGG No data
Right 924792593 1:247266491-247266513 GATGGTTTCCAGAACAGGCCAGG No data
924792583_924792592 4 Left 924792583 1:247266459-247266481 CCGGAATTGGGGTGCCCACTGGG No data
Right 924792592 1:247266486-247266508 GTGGGGATGGTTTCCAGAACAGG No data
924792583_924792590 -9 Left 924792583 1:247266459-247266481 CCGGAATTGGGGTGCCCACTGGG No data
Right 924792590 1:247266473-247266495 CCCACTGGGTGGTGTGGGGATGG No data
924792583_924792594 13 Left 924792583 1:247266459-247266481 CCGGAATTGGGGTGCCCACTGGG No data
Right 924792594 1:247266495-247266517 GTTTCCAGAACAGGCCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924792583 Original CRISPR CCCAGTGGGCACCCCAATTC CGG (reversed) Intergenic
No off target data available for this crispr