ID: 924794471 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:247283185-247283207 |
| Sequence | CTGTTTCGGGACATCGATCT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 924794468_924794471 | -8 | Left | 924794468 | 1:247283170-247283192 | CCTTATGTCTCTTTACTGTTTCG | No data | ||
| Right | 924794471 | 1:247283185-247283207 | CTGTTTCGGGACATCGATCTAGG | No data | ||||
| 924794466_924794471 | 23 | Left | 924794466 | 1:247283139-247283161 | CCATGCTTTGTTCAGATTTCCTC | No data | ||
| Right | 924794471 | 1:247283185-247283207 | CTGTTTCGGGACATCGATCTAGG | No data | ||||
| 924794467_924794471 | 4 | Left | 924794467 | 1:247283158-247283180 | CCTCAGTTTTCACCTTATGTCTC | No data | ||
| Right | 924794471 | 1:247283185-247283207 | CTGTTTCGGGACATCGATCTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 924794471 | Original CRISPR | CTGTTTCGGGACATCGATCT AGG | Intergenic | ||
| No off target data available for this crispr | |||||