ID: 924794471

View in Genome Browser
Species Human (GRCh38)
Location 1:247283185-247283207
Sequence CTGTTTCGGGACATCGATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924794468_924794471 -8 Left 924794468 1:247283170-247283192 CCTTATGTCTCTTTACTGTTTCG No data
Right 924794471 1:247283185-247283207 CTGTTTCGGGACATCGATCTAGG No data
924794466_924794471 23 Left 924794466 1:247283139-247283161 CCATGCTTTGTTCAGATTTCCTC No data
Right 924794471 1:247283185-247283207 CTGTTTCGGGACATCGATCTAGG No data
924794467_924794471 4 Left 924794467 1:247283158-247283180 CCTCAGTTTTCACCTTATGTCTC No data
Right 924794471 1:247283185-247283207 CTGTTTCGGGACATCGATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924794471 Original CRISPR CTGTTTCGGGACATCGATCT AGG Intergenic
No off target data available for this crispr