ID: 924795640

View in Genome Browser
Species Human (GRCh38)
Location 1:247290461-247290483
Sequence ACGCGCGCTGCTGGTGCAAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924795640_924795646 12 Left 924795640 1:247290461-247290483 CCGCTTGCACCAGCAGCGCGCGT No data
Right 924795646 1:247290496-247290518 GAAGCAGGAAGAGGGCCGGCCGG No data
924795640_924795644 4 Left 924795640 1:247290461-247290483 CCGCTTGCACCAGCAGCGCGCGT No data
Right 924795644 1:247290488-247290510 GAGAAGCAGAAGCAGGAAGAGGG No data
924795640_924795643 3 Left 924795640 1:247290461-247290483 CCGCTTGCACCAGCAGCGCGCGT No data
Right 924795643 1:247290487-247290509 CGAGAAGCAGAAGCAGGAAGAGG No data
924795640_924795642 -3 Left 924795640 1:247290461-247290483 CCGCTTGCACCAGCAGCGCGCGT No data
Right 924795642 1:247290481-247290503 CGTCAGCGAGAAGCAGAAGCAGG No data
924795640_924795648 28 Left 924795640 1:247290461-247290483 CCGCTTGCACCAGCAGCGCGCGT No data
Right 924795648 1:247290512-247290534 CGGCCGGAAGACACGCACCCCGG No data
924795640_924795645 8 Left 924795640 1:247290461-247290483 CCGCTTGCACCAGCAGCGCGCGT No data
Right 924795645 1:247290492-247290514 AGCAGAAGCAGGAAGAGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924795640 Original CRISPR ACGCGCGCTGCTGGTGCAAG CGG (reversed) Intergenic
No off target data available for this crispr