ID: 924796959

View in Genome Browser
Species Human (GRCh38)
Location 1:247299707-247299729
Sequence GCATTTACCAAGGATCTTTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 116}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924796951_924796959 14 Left 924796951 1:247299670-247299692 CCTTTTAAACGATGACAACTCCG 0: 1
1: 0
2: 0
3: 2
4: 53
Right 924796959 1:247299707-247299729 GCATTTACCAAGGATCTTTGGGG 0: 1
1: 0
2: 2
3: 14
4: 116
924796952_924796959 -6 Left 924796952 1:247299690-247299712 CCGCTTCCAACCCACAAGCATTT 0: 1
1: 0
2: 1
3: 25
4: 273
Right 924796959 1:247299707-247299729 GCATTTACCAAGGATCTTTGGGG 0: 1
1: 0
2: 2
3: 14
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924796959 Original CRISPR GCATTTACCAAGGATCTTTG GGG Exonic
903532486 1:24042265-24042287 CTCTTTACCAAGGATCCTTGGGG + Intergenic
904544151 1:31255247-31255269 GCTTTTTCCAAGAGTCTTTGGGG - Intergenic
919720532 1:200829251-200829273 GCATTTAAAAATCATCTTTGTGG + Intronic
922331600 1:224581785-224581807 TCCTTTGCCAAGGATCTTTGGGG + Intronic
922945106 1:229507626-229507648 GCATTAAACAATGATCTTTCAGG + Intronic
923299337 1:232627207-232627229 GCATTTACCAATTATGGTTGGGG + Intergenic
924262119 1:242242772-242242794 ACATATACCAAAGATCTGTGGGG + Intronic
924363924 1:243269481-243269503 GCACTAACCAAGAATCTATGAGG + Intronic
924796959 1:247299707-247299729 GCATTTACCAAGGATCTTTGGGG + Exonic
1067169106 10:43891424-43891446 ACATTTAGCTAGCATCTTTGTGG - Intergenic
1071569265 10:86687530-86687552 GCATTTTCCCAGGCTCTATGAGG + Intronic
1076470964 10:130717875-130717897 GCATTTATTAAGAATCATTGTGG + Intergenic
1079885045 11:25977196-25977218 GAATTTAACAATGATCTTAGAGG - Intergenic
1080259359 11:30329659-30329681 GCATTTTCCTAGGAACTATGGGG + Intronic
1080319891 11:30995731-30995753 GTATTTATCAAGGTTCTTTTTGG - Intronic
1086225648 11:84505760-84505782 GCATTTATCAAGGACATATGGGG + Intronic
1086964451 11:93013326-93013348 GCTTATAACATGGATCTTTGTGG - Intergenic
1087108209 11:94433254-94433276 ACATTTACAAAGGATCACTGTGG - Intronic
1088706873 11:112471693-112471715 CCATTTACCAAGGAACTGTAAGG - Intergenic
1093592873 12:20926959-20926981 GCTTTTATCAAGAATATTTGTGG + Intergenic
1100040820 12:90314758-90314780 GCAGTTGTTAAGGATCTTTGTGG - Intergenic
1101751445 12:107585780-107585802 TCATTTACCAAAGATGTATGGGG + Intronic
1103170827 12:118818262-118818284 GCACTTACCAATGATGTTTTTGG - Intergenic
1104517435 12:129440967-129440989 GCATTTACCAATTATCGTTGAGG + Intronic
1105575425 13:21646615-21646637 TAATTTACTCAGGATCTTTGAGG + Intergenic
1107178816 13:37432164-37432186 GAATTTAGGAAGGATATTTGTGG + Intergenic
1107521094 13:41182498-41182520 GCATGTTCCAAGCATCTTGGTGG - Intergenic
1110504307 13:76267771-76267793 GGATTTACAAAGGATCTTTGTGG - Intergenic
1118674455 14:68168396-68168418 TCGTTTACCAACGATCTATGAGG + Intronic
1119117140 14:72034599-72034621 GTATTTATCAGGGATCCTTGTGG + Intronic
1122102218 14:99421937-99421959 GTATTTACCAAGCATTTTTCTGG - Intronic
1128270534 15:66305366-66305388 GCATTTAACAAGATTCGTTGGGG + Intronic
1130750424 15:86705732-86705754 GCATTTTCACTGGATCTTTGAGG + Intronic
1140938467 16:79698217-79698239 ACATTGCCAAAGGATCTTTGTGG - Intergenic
1142713363 17:1735450-1735472 GCATTTTCTAAGGATCCCTGGGG + Intronic
1143926888 17:10378985-10379007 GAATTTACCAAAGATATTTTAGG + Intergenic
1144311264 17:14016195-14016217 GCATGTGCCAAGGCCCTTTGGGG - Intergenic
1146632668 17:34482190-34482212 GCATTTACCAAGCATCTACTAGG + Intergenic
1147858544 17:43501831-43501853 GCATTTCCAAAGGATGATTGAGG + Intronic
1152522192 17:80863008-80863030 TCATTTCCCAAGCACCTTTGGGG + Intronic
1153216540 18:2826072-2826094 GAAATTACCACAGATCTTTGGGG + Intergenic
1153769299 18:8402191-8402213 GCATTTACCCAGGTGCTTGGGGG + Intronic
1158054798 18:53265909-53265931 GCATCTTCCAAGGATCTCTTTGG + Intronic
1159346692 18:67215713-67215735 GCATTTCCCAGGGGACTTTGCGG + Intergenic
1166592199 19:44009358-44009380 GCATTTCCCAAGGATCATTTTGG - Intronic
1168618487 19:57857275-57857297 ACATTTGCCAAGTATTTTTGGGG + Intronic
925841021 2:7992213-7992235 CCAGTTACTAAGGATTTTTGTGG + Intergenic
925993013 2:9269019-9269041 GCATTTTGCATGGATCCTTGAGG + Intronic
928569905 2:32596099-32596121 GCAATTACCAAGGTTTTTTATGG + Intronic
939308565 2:140441338-140441360 GCAATTACCAGGGAGTTTTGTGG - Intronic
940502678 2:154513733-154513755 GCATTTTCCATGGATCATTCTGG + Intergenic
945482095 2:210356827-210356849 GTATTTACCTTTGATCTTTGAGG + Intergenic
948279390 2:236734908-236734930 GCATTTCCCATGGATGTCTGTGG + Intergenic
948564573 2:238875813-238875835 GTCTTTGCCAAGGATCTGTGAGG - Intronic
948743558 2:240067148-240067170 GCCTTTGCCATGGATATTTGAGG + Intergenic
1173341106 20:42153865-42153887 AGAGTTACCAAGGATCTTGGAGG - Intronic
1174826614 20:53774457-53774479 GCATTTACCAGGGATTGATGTGG + Intergenic
1177430123 21:20981826-20981848 GCCTTTAAAAAGGATCTTTTTGG + Intergenic
1179216364 21:39370528-39370550 GGGTTGACCAAGGTTCTTTGGGG - Intergenic
1180071649 21:45439788-45439810 GCATTTCCCGAGCATCTTAGAGG - Intronic
1180904117 22:19396634-19396656 GGATTCACCAAGGCTCTCTGGGG - Intronic
1184329643 22:43819220-43819242 GTTTTTACCAAGGACCTTAGGGG - Intergenic
1185214146 22:49589019-49589041 GCATTTCCCCAGGCTCTATGGGG - Intronic
1185217885 22:49613577-49613599 CCATTTACCAAGGGTAATTGTGG + Intronic
949417190 3:3827603-3827625 GCATTTGCCATGGATCTATTTGG + Intronic
950425606 3:12923335-12923357 GCATTTACCAAGGAGCTCATGGG + Intronic
955995257 3:64674196-64674218 TAATTTACCAAGGATTTTAGAGG + Intronic
957774786 3:84743687-84743709 GCAATTCCCAATGATTTTTGAGG - Intergenic
961621201 3:128226467-128226489 GCACTTCCCCAGGATCTTTGGGG - Intronic
961838060 3:129681141-129681163 GCATTTTCCAAACATCTATGGGG + Intronic
962719985 3:138164525-138164547 GCAGGCACAAAGGATCTTTGGGG + Intronic
964648050 3:158979946-158979968 GCACTTACCATGGAGCTTTCAGG - Intronic
964897030 3:161610986-161611008 GAATTTACCAAAGATATTTTAGG - Intergenic
965375376 3:167916513-167916535 CCATTTACCAAGTGTCTTTGTGG + Intergenic
967175151 3:186855866-186855888 GCATTTATCAAGGATCTGCAAGG - Exonic
967242466 3:187454325-187454347 GCATAGACTAAGGATCTTTGAGG + Intergenic
967276005 3:187775130-187775152 GCACTTACCAATGATATCTGGGG + Intergenic
971409574 4:26355828-26355850 GCATTTCCCAAGGAGCATTGAGG + Intronic
973671617 4:53224611-53224633 GCATCTACTAAGGTTATTTGGGG - Intronic
975215970 4:71755017-71755039 GCATTCACCAAGGCTTTTTAGGG + Exonic
976553953 4:86428955-86428977 GCATTTACCAAGGTTCTTGCGGG + Intronic
980980044 4:139647046-139647068 GCATTTACCAAATATCTGGGAGG - Intergenic
983693255 4:170498384-170498406 GCATTTAAAAAGTATCTTTATGG + Intergenic
986352337 5:6892181-6892203 GACTTTACCAAGGATCTTTGAGG + Intergenic
988702395 5:33688452-33688474 GCATTTTCCAGGGATCTTCTAGG - Intronic
990650710 5:57896345-57896367 GCATTTACTAGGAATCCTTGTGG - Intergenic
993088530 5:83394932-83394954 GCATTTACCTAGGAACTTGCAGG + Intergenic
993203911 5:84854130-84854152 GCTTTTACAAAGGATTGTTGAGG + Intergenic
994469611 5:100186495-100186517 GTATTCAGCAAAGATCTTTGGGG - Intergenic
998892390 5:146760404-146760426 GCATTTATTAAGTGTCTTTGTGG + Intronic
1000733495 5:164867845-164867867 GTATTTAGAAATGATCTTTGGGG + Intergenic
1001643989 5:173266532-173266554 TCCGTTACCAAGGATCTTAGTGG + Intergenic
1001802432 5:174555922-174555944 GAATTGACCAAGGACCTCTGGGG - Intergenic
1004383589 6:15153062-15153084 GAGTTTCCCAAAGATCTTTGTGG + Intergenic
1006875173 6:37289265-37289287 GCAATTATCAAGTATCTTTCAGG - Intronic
1007738226 6:43995003-43995025 GCATGAACCAAACATCTTTGAGG - Intergenic
1009333003 6:62447769-62447791 GCATTTATGAAGGATTTTTGTGG + Intergenic
1009747526 6:67837320-67837342 GCATTTAACAAGGTTTTTTGGGG + Intergenic
1012173758 6:96052445-96052467 GCATTTTCCAAGAAGCTATGGGG - Intronic
1014632746 6:123806437-123806459 ACAATTACCAAGAATCTCTGAGG - Intronic
1015054989 6:128889896-128889918 ACATTTACAAAAGATCATTGAGG + Intronic
1015491696 6:133834115-133834137 GCATTTACAAAGGATCCTGGAGG - Intergenic
1016004162 6:139072136-139072158 GCATTTCCCACAGATCATTGTGG + Intergenic
1017286100 6:152677849-152677871 TCATGTCCCAAGGTTCTTTGAGG + Intergenic
1024729676 7:52240236-52240258 GTATGCACCAAGGGTCTTTGAGG - Intergenic
1031316102 7:120259591-120259613 GCATTTACCATGGAGCTATCTGG - Intergenic
1032653103 7:133900134-133900156 GCATTTACCAAGATGCTGTGAGG + Intronic
1035031535 7:155864077-155864099 GCACTCACCAAGGATTTTTGGGG + Intergenic
1037421759 8:18709846-18709868 TTATTTACCTTGGATCTTTGAGG - Intronic
1040349055 8:46544716-46544738 GGATTTACAAAGAATCTATGTGG + Intergenic
1040447983 8:47515506-47515528 ACACTTCCCAAGGATCCTTGGGG - Intronic
1041488727 8:58408851-58408873 GCCTTTACCAAGATTCTTTCTGG + Intergenic
1043501511 8:80862223-80862245 GAATTTAACCAAGATCTTTGAGG + Intronic
1044700709 8:94963254-94963276 GCATTTAACAAGCATTTTTGAGG + Intronic
1045346748 8:101300424-101300446 GCATTTATCAAGAATCTTAAAGG - Intergenic
1045738637 8:105325989-105326011 GTATTTAGAAAGTATCTTTGAGG + Intronic
1046077214 8:109327465-109327487 GCTTTTCCTAATGATCTTTGTGG - Intronic
1047725399 8:127679821-127679843 GCATTTTCAGAGGAGCTTTGAGG - Intergenic
1048358191 8:133671133-133671155 GCATTTAGCACAGAACTTTGTGG + Intergenic
1048826251 8:138430282-138430304 GCATATACCAAGCATCTTACTGG - Intronic
1053279777 9:36812413-36812435 ACATTTACCTATGATGTTTGAGG + Intergenic
1057851991 9:98572964-98572986 GCATTTTCCCAGGCTCCTTGTGG - Intronic
1058726165 9:107806585-107806607 GCACTTAACAAGGAACTTGGAGG - Intergenic
1059661930 9:116410108-116410130 GCATTTGGCAGGGAGCTTTGTGG - Intergenic
1060242119 9:121912815-121912837 GCCTTTCCCAAGGATCTTTATGG - Intronic
1186143848 X:6604922-6604944 GCATTTTCAAAGGACCATTGAGG - Intergenic
1187839033 X:23466671-23466693 TCATTTTCCAAGGACATTTGTGG - Intergenic
1188963757 X:36525691-36525713 GCATTTCGCAAAGATTTTTGAGG - Intergenic
1194185131 X:90765831-90765853 GCACTCACCATGGGTCTTTGCGG - Intergenic
1199437429 X:147828553-147828575 GCATTCACCACGGGACTTTGAGG + Intergenic
1199903417 X:152200170-152200192 GCATATCGCAAGGGTCTTTGGGG - Intronic
1200097442 X:153670821-153670843 GCCTTTCCCCAGGATCTCTGGGG - Exonic
1200531758 Y:4347942-4347964 GCACTCACCATGGGTCTTTGCGG - Intergenic