ID: 924798241

View in Genome Browser
Species Human (GRCh38)
Location 1:247308548-247308570
Sequence CATTCCAGGTAGAAGAAAGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 508
Summary {0: 1, 1: 1, 2: 4, 3: 66, 4: 436}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924798241_924798246 6 Left 924798241 1:247308548-247308570 CCTTCTTTCTTCTACCTGGAATG 0: 1
1: 1
2: 4
3: 66
4: 436
Right 924798246 1:247308577-247308599 GACTTGGAGAGTCTTTCCAGAGG 0: 1
1: 0
2: 0
3: 17
4: 173
924798241_924798248 15 Left 924798241 1:247308548-247308570 CCTTCTTTCTTCTACCTGGAATG 0: 1
1: 1
2: 4
3: 66
4: 436
Right 924798248 1:247308586-247308608 AGTCTTTCCAGAGGAGGAAATGG 0: 1
1: 0
2: 5
3: 43
4: 491
924798241_924798244 -10 Left 924798241 1:247308548-247308570 CCTTCTTTCTTCTACCTGGAATG 0: 1
1: 1
2: 4
3: 66
4: 436
Right 924798244 1:247308561-247308583 ACCTGGAATGGCTGGAGACTTGG 0: 1
1: 0
2: 1
3: 16
4: 295
924798241_924798247 9 Left 924798241 1:247308548-247308570 CCTTCTTTCTTCTACCTGGAATG 0: 1
1: 1
2: 4
3: 66
4: 436
Right 924798247 1:247308580-247308602 TTGGAGAGTCTTTCCAGAGGAGG 0: 1
1: 0
2: 3
3: 15
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924798241 Original CRISPR CATTCCAGGTAGAAGAAAGA AGG (reversed) Exonic
900375412 1:2352237-2352259 TATTCCAGCTAGGAGAAAGGGGG - Intronic
902723364 1:18319252-18319274 CATTCCAGCTAGGAGGAAGCAGG + Intronic
902811857 1:18892539-18892561 CATCCCAGGTAGAAGGAGGCGGG + Intronic
902902209 1:19525653-19525675 CATGCCAGCTTGAAAAAAGATGG - Intergenic
902961884 1:19969356-19969378 CATACCAGGTGGCAGAGAGATGG - Intergenic
903311202 1:22457952-22457974 AGTACCAGGTGGAAGAAAGATGG - Intronic
903798563 1:25949103-25949125 CATTCCAGGCAGAAGAAATAAGG - Intergenic
904316984 1:29671880-29671902 CATTCCAGATAGCAGAAGGCAGG - Intergenic
906239348 1:44232639-44232661 CATTCCAGGAAAAAGAAAGGGGG + Intronic
906537010 1:46556581-46556603 CACTCCAGGTAGATGAAAAAGGG + Intergenic
907717521 1:56940998-56941020 CATTCCAGACAGAAACAAGAGGG - Exonic
907971810 1:59390462-59390484 CAGTCCATGTAGCAGGAAGAAGG + Intronic
908194878 1:61738851-61738873 CATTCCAGGCAGGGGAAAGTGGG + Intergenic
908414260 1:63897541-63897563 CATTTTAGGAAAAAGAAAGAAGG - Intronic
909944762 1:81650936-81650958 CATGCCAGGTACAAGAGGGAGGG - Intronic
910426351 1:87123170-87123192 GATTCTAGGTAGAAGGAACATGG + Intronic
911023399 1:93411585-93411607 GATTCAAGGTTCAAGAAAGAGGG + Intergenic
912013167 1:104997114-104997136 CATTGAAGGCAGAAGACAGAAGG + Intergenic
912626223 1:111206522-111206544 CATTTAAAGTATAAGAAAGAGGG + Intronic
912906003 1:113708094-113708116 CAATCCAGAAAGAAGAAAAAAGG + Intronic
913588726 1:120302230-120302252 CTTTCCAGGTGGAAGAGAAAAGG + Intergenic
913619459 1:120596139-120596161 CTTTCCAGGTGGAAGAGAAAAGG - Intergenic
914327270 1:146631860-146631882 CATTCCAGCCAGCAGAAAGGAGG + Intergenic
914570749 1:148914101-148914123 CTTTCCAGGTGGAAGAGAAAAGG + Intronic
914602081 1:149216162-149216184 CTTTCCAGGTGGAAGAGAAAAGG - Intergenic
914780090 1:150777766-150777788 CTTACCAGGTAGATGTAAGAAGG - Intergenic
915182722 1:154077072-154077094 CATTCAAAGTAAAAGAAAAAGGG + Intronic
915315205 1:155024639-155024661 CATTCCAGGCAGACAAAACAGGG - Intronic
916731754 1:167572919-167572941 CTCTCCAGGTAGAAAAAAAAGGG - Intergenic
919467281 1:197937499-197937521 CATTCTGTGTACAAGAAAGAGGG + Intergenic
919920320 1:202163322-202163344 CACTCCAGGGAGGACAAAGAGGG + Intergenic
920814378 1:209317684-209317706 CAATCGAGATTGAAGAAAGAAGG + Intergenic
921103191 1:211949304-211949326 CGTTGCAGTTGGAAGAAAGATGG - Intronic
921168518 1:212525235-212525257 CATTCCAGGTGGGAGGAAGGGGG + Intergenic
921670207 1:217916582-217916604 CATTCTAAGTAGAAGAGGGATGG + Intergenic
922945394 1:229509427-229509449 CATTCCAGGTGAGAGAAACATGG - Intergenic
923392167 1:233523262-233523284 CATTCCAGGGAGACAAAGGAGGG + Intergenic
923767868 1:236909535-236909557 AATTTCAGGTAGGAGGAAGATGG + Intergenic
924324115 1:242878168-242878190 CATGCCAGGTAACAGCAAGAAGG + Intergenic
924798241 1:247308548-247308570 CATTCCAGGTAGAAGAAAGAAGG - Exonic
1065632260 10:27692443-27692465 TATTCCAGTTAGAAGAAGGAGGG - Intronic
1065856490 10:29834819-29834841 CAATCCAGGAAAAAGGAAGAAGG - Intergenic
1066475349 10:35741529-35741551 CATTCCAGGTAGGAATTAGAAGG + Intergenic
1066783172 10:38974241-38974263 GATTCCAGGTGGAAGAAGGGTGG - Intergenic
1069351548 10:67532695-67532717 GATACCAAGGAGAAGAAAGATGG + Intronic
1070082540 10:73203168-73203190 CTTTCCACGTAGCAGAAAGGAGG + Intronic
1070084365 10:73221627-73221649 AACTCCAGGCAGAAGAAACATGG - Intronic
1070409467 10:76126081-76126103 CCTTGCAGGTTGAAGAGAGAGGG + Intronic
1070473899 10:76813285-76813307 CATTCCAGCAGGAACAAAGAGGG - Intergenic
1070902928 10:80046712-80046734 CATACAATGTAGAAGAAGGAAGG + Intergenic
1071723433 10:88170474-88170496 CATCCCAGATAGCAGGAAGAGGG - Intergenic
1072459299 10:95604774-95604796 CATTCCAGCCAGCAGGAAGAAGG - Intergenic
1072615736 10:97047958-97047980 CATTCCAGGTAGGAGAGTGGGGG - Exonic
1073544248 10:104335640-104335662 CAGTCCAGGTGGAGGAAGGAGGG - Intronic
1074078743 10:110151615-110151637 CCATCCATGTAGAAGGAAGAGGG - Intergenic
1074437210 10:113444349-113444371 CATTCCAGGAAGGAAGAAGAGGG + Intergenic
1074456138 10:113596963-113596985 TCATCCAGGTAGTAGAAAGAAGG + Intronic
1074864229 10:117535606-117535628 TAAACCAGGAAGAAGAAAGAGGG + Intergenic
1074962404 10:118459120-118459142 CAGGCTAGGTAGAAGAAAGGAGG - Intergenic
1075353206 10:121744926-121744948 CGTTCCAGGCAGCAGAATGAAGG - Intronic
1076730674 10:132437381-132437403 CCTTCCAGGTGCAGGAAAGATGG + Intergenic
1076863351 10:133153669-133153691 CAATCCAGAAAAAAGAAAGAAGG + Intergenic
1076925987 10:133487614-133487636 CATTCCAGGAGGAGAAAAGAAGG - Intergenic
1077551968 11:3204444-3204466 CATTCCAGGTGCAAGGGAGAGGG - Intergenic
1078393101 11:10953388-10953410 CAATCCTGGTAGAACAAAAATGG + Intergenic
1078952435 11:16149428-16149450 CATTCCAGGAAGAAAACACAGGG + Intronic
1080347067 11:31336856-31336878 CATTCTAGGTAGCAGAAGGAAGG - Intronic
1081591777 11:44428070-44428092 CATTCCAAGAAGAAAAAAAAAGG - Intergenic
1081822015 11:46007853-46007875 CATTCCACTTAGGAGTAAGATGG - Intronic
1083273693 11:61585192-61585214 CATGCCAGGTAGAGGCCAGAGGG - Intergenic
1083834785 11:65259110-65259132 CATTCCAGGTAGCAGAAAGTAGG - Intergenic
1084362773 11:68679759-68679781 CACTCCAGGCAGCAGGAAGAAGG + Intergenic
1084627292 11:70318167-70318189 CATGCCGCGTAGAAGAAAGAGGG - Intronic
1086229584 11:84552218-84552240 TATTCTAGGGAGAAGAAACAAGG - Intronic
1086436581 11:86786977-86786999 GATTGCAGGTAGAATATAGAAGG - Intergenic
1087508393 11:99057966-99057988 TATTCTAGGTAGAGGAAACAGGG + Intronic
1088001648 11:104889073-104889095 AATTACATGTAAAAGAAAGAAGG + Intergenic
1088111566 11:106267523-106267545 CATTCCAAATAGAAAAAAAATGG - Intergenic
1088748869 11:112827079-112827101 CTTTCCTGATAGAAGAAAGCAGG + Intergenic
1089188652 11:116638114-116638136 CATTCCAGGTAGAGGGAATGAGG - Intergenic
1090067738 11:123518024-123518046 CCTGCCAGATGGAAGAAAGAAGG - Intergenic
1090424352 11:126596744-126596766 CCTTCCTGGAAGAAGAAAGCTGG - Intronic
1090445189 11:126758594-126758616 TTTTCAAGGTAGAAGATAGATGG + Intronic
1092306430 12:7305821-7305843 CATTCCAGATAGGGGAAAGAAGG + Intronic
1092910838 12:13143716-13143738 CATTCTAAGCAGGAGAAAGAAGG + Intergenic
1092944797 12:13442774-13442796 CATTCTAGGTAGAGGAAACCTGG + Intergenic
1093128250 12:15356599-15356621 CATTAAAGGTAGAAGAGAAAAGG - Intronic
1093818783 12:23585464-23585486 CATTACAGATAGAGGAAAGGGGG + Intronic
1094143779 12:27207736-27207758 CATTCCAGGCAGAAGGAGGTAGG - Intergenic
1094564342 12:31586247-31586269 TATTGCATGTAGAAGAAAGGAGG - Intronic
1095619920 12:44240274-44240296 CATTCCAGGTTGTAGGAAGAAGG + Intronic
1095634939 12:44421826-44421848 TATTCCAGGAAGAAGACAGAGGG - Intergenic
1096053775 12:48633906-48633928 CATTCCAGGAAGCAGCAAGGTGG + Intergenic
1096094855 12:48927712-48927734 CATTCCAGATAGCAGACAGAAGG - Intronic
1098230739 12:68369878-68369900 CATTCCAGGAAGAAGAGAAATGG + Intergenic
1098498081 12:71160085-71160107 TATTCCAGGCAGAAGGAACAAGG - Intronic
1099038937 12:77626349-77626371 AATTCCAGAAAGAAGAGAGAAGG + Intergenic
1099357528 12:81657484-81657506 CATTCCAGAAAGAATGAAGATGG - Intronic
1100419454 12:94417390-94417412 CTTTTCTGGTAGAGGAAAGAGGG - Intronic
1101210271 12:102528610-102528632 CCTTCCAGTTAGCAGGAAGAAGG - Intergenic
1101434881 12:104656006-104656028 GATTCCAGGCAGCAGAAAGAAGG + Intronic
1102187396 12:110959607-110959629 CATTCCAGGCAAAAGTAAGAGGG + Intergenic
1102401197 12:112631014-112631036 TATTCCAGGTAGGGGAAACAGGG + Intronic
1102717026 12:114982848-114982870 CATTCCAGCTGGAGAAAAGAGGG + Intergenic
1106170371 13:27283397-27283419 CATTCCTGGTAGCAGAAAGGGGG + Intergenic
1106368049 13:29103054-29103076 CTTTCCAAGAAGAAGAAAAAAGG - Intronic
1107356495 13:39572800-39572822 CCTTCCACTTAGGAGAAAGATGG - Intronic
1107729403 13:43333337-43333359 CATTCCTGATAGATGACAGAAGG + Intronic
1108804519 13:54137928-54137950 CATTCCAGGCAGAAGTTATAGGG + Intergenic
1109347759 13:61136460-61136482 CATTTCAGGTAGGAGGAAGGAGG + Intergenic
1109767423 13:66921497-66921519 TATTCCTGGTAAAATAAAGATGG - Intronic
1109935474 13:69277876-69277898 CATTTCAGCTAGCATAAAGATGG + Intergenic
1111374426 13:87359446-87359468 CATCCCAGAAAGAAAAAAGAGGG + Intergenic
1111695264 13:91615310-91615332 CATACTAGTTAGAAGAAGGAGGG + Intronic
1112364806 13:98747526-98747548 CATTCCATGAAGAACAAACAGGG - Intronic
1113001903 13:105648956-105648978 CATTCCAGGTAAACAAAAGCTGG + Intergenic
1113096233 13:106666884-106666906 CAGTGCAGGTAGAATAAAGCAGG - Intergenic
1113367226 13:109687694-109687716 CATTCCAGGAAGCAGGAAGAGGG + Intergenic
1113613767 13:111666277-111666299 CATTCCTGGAATAAGAATGATGG + Intronic
1114881271 14:26788990-26789012 CATTCTAGGGAGTAGAAAGTAGG + Intergenic
1115451890 14:33557376-33557398 CATTGTGGGTAGAAGACAGAGGG - Intronic
1115701667 14:35959444-35959466 CATTCCAGGAAGACCAGAGAGGG + Intergenic
1115778867 14:36747378-36747400 CATTACTAGTGGAAGAAAGATGG + Intronic
1116388187 14:44358672-44358694 CAAACCAGGTGGAAGAAAGTGGG - Intergenic
1117642552 14:57815590-57815612 CATCAGAGGTAGAAGTAAGAAGG - Intronic
1117953082 14:61102133-61102155 GATTCCAGGTAGAAGAACTGTGG + Intergenic
1118294881 14:64559587-64559609 CATTCTAGGGAGAAGGAACATGG + Intronic
1119497300 14:75091125-75091147 CTTTCCAGGTAGAAATCAGAAGG + Intronic
1120962345 14:90136799-90136821 CATTCCAGGTTGAACCGAGAGGG + Intronic
1121403464 14:93703194-93703216 CATTCCAGGAAGCAGAGAGAAGG - Intronic
1124475051 15:30025914-30025936 CCTTTCAGGCAGAGGAAAGATGG + Intergenic
1124705713 15:31962232-31962254 CATTCCTGGTGAAAGAAAAAGGG - Intergenic
1125869873 15:43090065-43090087 CATTACAGGAAACAGAAAGAGGG + Intronic
1128351949 15:66896840-66896862 CATTCTAGGTAGGAGAAAGGAGG + Intergenic
1128510683 15:68312319-68312341 CATTCCAGGCAGCAGGAAGGAGG - Intronic
1130573776 15:85072544-85072566 CATTCCAGATAGCAGGAAAAAGG - Intronic
1131163951 15:90128824-90128846 CCTTCCAAGAAGGAGAAAGACGG + Intergenic
1131467808 15:92669453-92669475 CATTCCTGGTGGAAGAACCAGGG - Intronic
1132417541 15:101633553-101633575 CAGTCCTTGAAGAAGAAAGATGG - Intronic
1133307977 16:4823108-4823130 CATTCCAGCTAGAGGAAAACTGG + Intronic
1134132776 16:11660885-11660907 CATTCGAGGGAGAAGATCGAAGG - Intergenic
1134790982 16:16989093-16989115 CATTCCAGGTAGAAGAAACATGG + Intergenic
1135887977 16:26329615-26329637 AATTCTAGGTAGAAGAGGGAGGG - Intergenic
1136057408 16:27700654-27700676 CATTCCAGGTGGAAGGAACGGGG + Intronic
1136344398 16:29665539-29665561 GTTTCCAGGAACAAGAAAGAGGG - Exonic
1137873467 16:51972693-51972715 TATTCCAGGAAGAAACAAGAAGG + Intergenic
1138645439 16:58421108-58421130 CATTCCAGGCTGGAGAAGGATGG + Intergenic
1139690852 16:68641166-68641188 CATTCCAGGCAGAGAAAACAGGG - Intronic
1140006290 16:71079079-71079101 CATTCCAGCCAGCAGAAAGGAGG - Intronic
1141056279 16:80817672-80817694 CATTCCAGGATGCAGAGAGAAGG - Intergenic
1141137771 16:81477866-81477888 CATTCCAGTTAGCAGAAAGTGGG + Intronic
1141675208 16:85514049-85514071 GATTCCAGGCTGAAGAAAGAGGG + Intergenic
1141795764 16:86272884-86272906 CATTCCAGGCAGAAAAAAAGTGG - Intergenic
1142346877 16:89559808-89559830 GTTTCCAGGTAGCAGTAAGATGG + Intergenic
1143734024 17:8897736-8897758 CATTCCAGTTAACAGAAAGAAGG - Intronic
1143992489 17:10978114-10978136 CATTCCAGGCAGAAGTAATAGGG - Intergenic
1144333974 17:14252788-14252810 CATTCCAGGAGGAAGAAAGAGGG + Intergenic
1144452045 17:15389232-15389254 CATTCCAGGTGACAGAAAGGAGG - Intergenic
1144919277 17:18749992-18750014 CATTCCTGGAAAAAAAAAGATGG - Exonic
1147222023 17:38940607-38940629 TATTCAAGGCAGAAGAAAAATGG - Intronic
1147244959 17:39114031-39114053 CATTCCAGGCAGGAAGAAGAAGG - Intronic
1147498110 17:40936939-40936961 CATTCCAGGTAAATGAACAATGG - Exonic
1148572791 17:48683839-48683861 TCTTCCAGGTTGGAGAAAGAGGG + Intergenic
1148995822 17:51708711-51708733 CAGTGCAGGTAGAATAAAGCAGG + Intronic
1149855936 17:60082691-60082713 CATTCCAGGCAGAATGAAGTGGG - Intergenic
1150280745 17:63928559-63928581 CGTTCCAGGGAGAAGAAACGGGG + Intergenic
1153132428 18:1871059-1871081 CATCCCAGGTAGAACAAAGTAGG + Intergenic
1153160200 18:2196232-2196254 CTTTCCAGGAAGAAGAAGGCTGG + Intergenic
1153540110 18:6144811-6144833 CATTCCAGGGAGTCCAAAGATGG - Intronic
1155519346 18:26653327-26653349 AGTTCCAGGGAGAAAAAAGAAGG - Intronic
1155851883 18:30784186-30784208 CATTCCTGGGAGAAGAATGTGGG + Intergenic
1156362627 18:36397852-36397874 CATTCTAGGCAGCAGAAAGGAGG + Intronic
1156483957 18:37453100-37453122 CATTCCAGGTAGAGGGAACCCGG - Intronic
1156680146 18:39578479-39578501 CATTACAGATGTAAGAAAGATGG + Intergenic
1157543054 18:48525720-48525742 CATTCCAGGTAGTAGGAATGAGG + Intergenic
1157683970 18:49628255-49628277 CATCCCAGTTAGATCAAAGAGGG + Intergenic
1157757534 18:50231968-50231990 CAGTCCAGGTACAAGGAAAATGG - Intronic
1158311389 18:56163170-56163192 CATTCCAGGGGGAAAAAAAAAGG - Intergenic
1158444415 18:57506777-57506799 TATTCCAGAAAGAAGGAAGAGGG - Intergenic
1158696346 18:59707464-59707486 CATTGCAGGAAGAAGCAAGAAGG - Intergenic
1159151601 18:64530163-64530185 CAGTGCAGGTAGAATAAAGCAGG - Intergenic
1160231310 18:77051703-77051725 CCTTCCAGGGAGAAGAAGAAAGG + Intronic
1160913791 19:1487415-1487437 CACTCCAGGGAGCAGAGAGAGGG - Intronic
1161645267 19:5449481-5449503 CATTCCTGGTAGAGGACAAAGGG + Intergenic
1161999451 19:7734022-7734044 CATTCCTGGAAGAAGAAAGGGGG - Intergenic
1163542706 19:17920750-17920772 CATTCAAGGCAGAAACAAGAGGG + Intergenic
1163998119 19:21071477-21071499 AATTCCAAAAAGAAGAAAGAAGG + Intergenic
1164019231 19:21282962-21282984 GATTCCAAAAAGAAGAAAGAAGG - Intronic
1164374317 19:27672234-27672256 GATTGCAGGTAGTATAAAGATGG - Intergenic
1165946103 19:39443488-39443510 CATTCCCTGCAGAAAAAAGAGGG - Intronic
1167597915 19:50436990-50437012 CATTCCACGTTTAAGAAAGTAGG + Intronic
1167640141 19:50676949-50676971 CATTCCAGGTAGCAGGAACAAGG - Intronic
1167692735 19:50996763-50996785 CAATCCAGGGAGAAGACAGTAGG + Intronic
1167726514 19:51216901-51216923 CATCCCAGGAAGAAGGAAAAGGG + Intergenic
925112851 2:1351537-1351559 CTGAACAGGTAGAAGAAAGAGGG + Intronic
925269837 2:2596396-2596418 CATTCCAGATACAAGAAGAAAGG - Intergenic
926376648 2:12235548-12235570 CATTCCAACCAGCAGAAAGAAGG - Intergenic
926385580 2:12332820-12332842 CATTCCAGTGAGCAGAAAGCTGG - Intergenic
926590474 2:14735047-14735069 CATTCCAGGCAGGAGGAAGAGGG - Intergenic
926628604 2:15117125-15117147 CATACCTGGCAGAGGAAAGAGGG + Intergenic
926954349 2:18277923-18277945 CATTCCAGGTACTAAGAAGATGG - Intronic
927126485 2:20016476-20016498 CATTCCAGGATGAAGGAAGAGGG + Intergenic
927186358 2:20485294-20485316 CAGCCCAGGTAGAAGGAAGATGG - Intergenic
927316478 2:21689054-21689076 CAGTTCTGGTAGGAGAAAGAAGG + Intergenic
928956524 2:36875178-36875200 AATTCCAAGTAGTAGAAAGGTGG + Intronic
930748016 2:54904553-54904575 CATTCCAGGCAAAAGGAATATGG + Intronic
930780296 2:55218238-55218260 CATACCAAGTAGAACAAAAATGG - Intronic
930977667 2:57483648-57483670 AATTTGATGTAGAAGAAAGAGGG + Intergenic
931055016 2:58459993-58460015 CATTGCAGGTAGAGAAAAGATGG + Intergenic
931285766 2:60830338-60830360 CATGCCAGGCAGAAGGAGGAAGG + Intergenic
931647715 2:64440300-64440322 TATTCCAGGGAGAACAAAAAAGG - Intergenic
932688786 2:73895025-73895047 CCGTGCAGGTAGAAGTAAGAAGG + Intronic
932734271 2:74243347-74243369 CAGTTCAGGAAGAAGAGAGAGGG - Intronic
934169180 2:89325334-89325356 CAAACCAGCTAGAACAAAGATGG + Intergenic
934198113 2:89857250-89857272 CAAACCAGCTAGAACAAAGATGG - Intergenic
935242275 2:101189167-101189189 CATCCCAGCTAGAAGGAAGGAGG - Intronic
935876211 2:107510981-107511003 CACTCAAGAAAGAAGAAAGAAGG - Intergenic
936288001 2:111196516-111196538 CATTGCAGGTGGAAGAGCGACGG - Intergenic
936938754 2:117861534-117861556 CATTTAATGTAGAAGAAAAAAGG - Intergenic
937242516 2:120471463-120471485 CATTCCAGAAAGGAGAGAGATGG - Intergenic
937616160 2:123924262-123924284 GAATACAGGAAGAAGAAAGAAGG - Intergenic
937703568 2:124891953-124891975 TGTTCCAGGGAGAAGAAAGCAGG - Intronic
938228033 2:129634748-129634770 CAATCCTGGAATAAGAAAGATGG - Intergenic
938476453 2:131618960-131618982 CTTTCCAAGAAGAAGAAAAAGGG + Intergenic
939715463 2:145578529-145578551 CATTCTAGGTAGAAGGAATGAGG + Intergenic
940019540 2:149142352-149142374 CATTCCTGGAAAAAGCAAGATGG - Intronic
940322631 2:152392834-152392856 CAATCCAGTTAGAAGCCAGAGGG - Intronic
940494963 2:154416003-154416025 CATGCAAGCTAGAAGAAAGCAGG + Intronic
940676601 2:156731074-156731096 CATTCCAGGTGGAGGAAAAAAGG + Intergenic
941207194 2:162588896-162588918 CATTGGAGGGAGAGGAAAGAGGG - Intronic
941254592 2:163212920-163212942 CATTCCATGTAGCAGCAGGATGG + Intergenic
941294801 2:163723596-163723618 CATGCCAGGAAGCAAAAAGAAGG + Intronic
942074487 2:172343964-172343986 TTCACCAGGTAGAAGAAAGAGGG - Intergenic
942225922 2:173815980-173816002 GATTCCAGGTAGTACAAAGAAGG + Intergenic
942841417 2:180366218-180366240 GATTTCATGAAGAAGAAAGAAGG + Intergenic
943559039 2:189439421-189439443 CCTTTCAGTTAGAAGAAATAAGG - Intergenic
943661602 2:190565214-190565236 CAAGCCTGATAGAAGAAAGAAGG + Intergenic
945743381 2:213690650-213690672 CAGTGCAGGTAGAACAAAGCAGG + Intronic
945814055 2:214582322-214582344 AAGTCCAGGAAGAAGAATGAGGG + Intergenic
946748616 2:222870654-222870676 CATTCCAGGTAGAGCTAACAGGG + Intronic
947145797 2:227063684-227063706 CATTCTAGTGAGAAAAAAGAAGG - Intronic
947295242 2:228623803-228623825 CAGCCCAGGGAGAAGCAAGAGGG - Intergenic
947643574 2:231721626-231721648 CTTTCCAAGCAGAGGAAAGACGG + Intergenic
948443236 2:238011319-238011341 CACTCCAGGCAGATGAAACAGGG - Intronic
1168880555 20:1202922-1202944 CATTCAAGGCAGAAGGAAAAGGG + Intergenic
1168916659 20:1493789-1493811 GATTCCATCTAGAACAAAGAAGG - Intergenic
1168958528 20:1851725-1851747 CATTCCAGGTATGAAGAAGAAGG - Intergenic
1168998670 20:2150925-2150947 CATGCCAGGTATAACAGAGAGGG + Intronic
1169046996 20:2541033-2541055 GATTCCAGGCAGAGGAAACAGGG - Intronic
1169366398 20:4996248-4996270 CATTCAACTTAGAAGATAGAGGG + Intronic
1171308744 20:24128447-24128469 TATTCAAGGTAAAAGAAAGAGGG - Intergenic
1172577674 20:36021829-36021851 CCTTCCAGATAGAACAAAGTAGG + Intronic
1172935780 20:38619142-38619164 CATTCCAGGCAGAGGGAAGAAGG + Intronic
1173051462 20:39566121-39566143 CCATCCAGGTAGGAGATAGAGGG - Intergenic
1173167479 20:40695641-40695663 TGATCCAGGTTGAAGAAAGATGG - Intergenic
1173248024 20:41349562-41349584 CAATCCAGTAAGAAGAAGGATGG - Intronic
1173324185 20:42017564-42017586 CTTTCCAGGTAGAAAAAAGGAGG - Intergenic
1174895293 20:54442772-54442794 CAATCATAGTAGAAGAAAGACGG - Intergenic
1174985257 20:55444300-55444322 GCATCCAGGTAGAAGAAATAGGG + Intergenic
1175147333 20:56906888-56906910 CATTCCAGCCAGAGGAATGAAGG + Intergenic
1177459222 21:21388393-21388415 CATTCCAGGCAGAGGGAACAAGG + Intronic
1177631957 21:23740648-23740670 TATTCCAGCTTGAAGAAAGAGGG - Intergenic
1177676467 21:24307658-24307680 CATTCCAGGATGAAGAAATATGG - Intergenic
1177886825 21:26757357-26757379 CATTTCAGGAAGAAAAAAAATGG - Intergenic
1178215144 21:30588104-30588126 AATTCCAGGGGGAAAAAAGATGG - Intergenic
1179128865 21:38616562-38616584 TATTCCAGGTATAAGATATATGG + Intronic
1179145168 21:38761675-38761697 GCTTCCAGGGAGAAGAAAAAAGG - Intergenic
1179353433 21:40635160-40635182 CAGACAAGGCAGAAGAAAGAAGG + Intronic
1179418105 21:41214621-41214643 CATTCCAGGCAAAAGGAAGGTGG - Intronic
1181018546 22:20085679-20085701 CTTTGCAGGTAGAAGAAGAAAGG + Exonic
1181144923 22:20838666-20838688 TCTTCCAGTTAGATGAAAGACGG - Exonic
1181324150 22:22032108-22032130 CAGCCCAGGGAGAAGAAAGAGGG + Intergenic
1182437942 22:30342560-30342582 CACTCTAGCTAGAAGACAGAAGG - Intronic
1182677669 22:32052534-32052556 CACTCCAGGAAGAAGTGAGAAGG + Intronic
1183473982 22:38025889-38025911 CATCCCATGTAGAAGACAGGAGG - Intronic
949293511 3:2493845-2493867 TATTCCAGGCAGCAAAAAGAAGG - Intronic
949709677 3:6860192-6860214 GATGGCAGGAAGAAGAAAGAGGG - Intronic
950786697 3:15442948-15442970 CATTCCAGGCAGAAGGAATCTGG - Intronic
950936951 3:16848866-16848888 CATGCAAGGTAGAAAAAAAAAGG - Intronic
951438877 3:22698535-22698557 CATACCAGAAAGAAAAAAGATGG + Intergenic
951532397 3:23710091-23710113 CATTGCAGGTTGAAGGAACAGGG - Intergenic
951704063 3:25526155-25526177 CATTCCAGGTAGGAGAGCAAAGG + Intronic
951922203 3:27868855-27868877 CTTTCAGGGCAGAAGAAAGAGGG - Intergenic
952470782 3:33649121-33649143 CATTCTAGGCAGAAGAAGCAAGG - Intronic
952832845 3:37579409-37579431 AATTCCAGATAGGAAAAAGAAGG + Intronic
953352686 3:42227771-42227793 CATTCCAAGCAGAGGAAGGATGG + Intergenic
953972034 3:47355485-47355507 AATTCCAGGCAGAGGAAAGCAGG + Intergenic
954127911 3:48543050-48543072 GACTCCAGGAAGAAGAAGGAAGG + Intronic
954143809 3:48624068-48624090 AATTCCAGCCATAAGAAAGAAGG - Intergenic
954678254 3:52327315-52327337 GAATCCAGGGAGGAGAAAGAGGG + Intronic
954711541 3:52507461-52507483 CATTCCAGGCAGAGGAGAGCAGG - Intronic
955037268 3:55281282-55281304 CATTCCAGACAGCAGAATGAAGG + Intergenic
955154014 3:56397903-56397925 CATTCCAGGCAGCAGAAGAAGGG + Intronic
955611506 3:60762408-60762430 CATCACAGGCAGAAGAAAGAGGG - Intronic
955709624 3:61764652-61764674 CATTGCAGGTAGAGGGAAGCGGG + Intronic
955761513 3:62289184-62289206 CATTTCAGGTTGAATAAATAAGG - Intronic
956426897 3:69145189-69145211 CACTCCAGGCAGAAAAAAGGAGG + Intergenic
956892947 3:73630329-73630351 CATTCCAGGCAGAAAAATGGAGG + Intergenic
958539270 3:95449241-95449263 CAATACAAGTAGAGGAAAGAAGG - Intergenic
958761111 3:98309572-98309594 CATTCTAGGTGCAAGAAGGATGG + Intergenic
958901096 3:99887356-99887378 CATTCCAGGAAGGAGAATGGTGG + Intronic
959252422 3:103965661-103965683 CACTCCAGGGAGAAGAAGGCAGG + Intergenic
959963912 3:112332889-112332911 CAGTCCAGGTAGCAGGAAAATGG + Intronic
960684248 3:120281032-120281054 CATTCCAAGTGGAAGAATGGGGG - Intronic
961668028 3:128505890-128505912 CATTCCAGGGAGCAGCAAGGAGG + Intergenic
961684772 3:128622183-128622205 CAGTCCAGGCTGAAGACAGAGGG - Exonic
963121837 3:141783087-141783109 TGTTCCAGGTAGGAGAAAGGAGG + Intronic
963262867 3:143210524-143210546 CCTTCCAGGAAGAACAAGGATGG + Intergenic
963301961 3:143608399-143608421 CATTCCAGGGAGGACAAAGAGGG - Intronic
963349047 3:144130604-144130626 CGTTCCATGTGGGAGAAAGAAGG - Intergenic
963502339 3:146143595-146143617 CATTCCGGCCAGTAGAAAGAAGG - Intronic
963827184 3:149969337-149969359 CATTCCATGAATAAGAAGGAAGG + Intronic
964034745 3:152182114-152182136 CATTCCAAGAAGAAAAAAAAAGG + Intergenic
964551955 3:157894899-157894921 CATACCAGGTAGTAGAAGGAAGG + Intergenic
964739097 3:159946692-159946714 CATTCCAGTCATAAGGAAGATGG + Intergenic
965636970 3:170792220-170792242 CATCCCTGGTGGAAGACAGATGG + Intronic
965693444 3:171381812-171381834 CATTCCAGGCAGCAGGAAGGAGG - Intronic
967242884 3:187458335-187458357 CATTCCAGAGAGAAGAAAGGAGG + Intergenic
968849799 4:3071375-3071397 CATTCCAGGGAGCAGGAAAAAGG + Intergenic
969034421 4:4241516-4241538 CAATCCATGTGGAAGAGAGAGGG + Intronic
969055769 4:4401718-4401740 GATTCCAGTAAGAAGGAAGAAGG + Intronic
969312822 4:6364029-6364051 TATTCCAGGTAGATCAAACAAGG + Intronic
969910575 4:10441613-10441635 CCTTCCAGGTAGAGCACAGATGG - Exonic
969995066 4:11303543-11303565 AAGACAAGGTAGAAGAAAGAGGG - Intergenic
970668432 4:18366324-18366346 GATTCCAGGGAGAAGAATGTGGG + Intergenic
970765725 4:19546433-19546455 GATTCCAGGTTCAAGATAGATGG - Intergenic
971189609 4:24414817-24414839 CATTCCAGCAAGAAGGAAGAAGG - Intergenic
971981997 4:33763622-33763644 CATTCCATATGGGAGAAAGAAGG - Intergenic
971996021 4:33965744-33965766 CATTCCAGGTAAAAGAGAGTAGG + Intergenic
973742245 4:53929365-53929387 CATTTTAGAAAGAAGAAAGAAGG - Intronic
974576640 4:63733018-63733040 CATTCCTGGTTGAAGAAGGAAGG - Intergenic
974640974 4:64630210-64630232 AAATTCAGGTATAAGAAAGAGGG - Intergenic
974825643 4:67126223-67126245 CATCCCAGGTAGGACAAAGCAGG + Intergenic
976243456 4:82984146-82984168 CAGTACAGGTAAAAGAAAAAAGG - Exonic
976361977 4:84190396-84190418 TTCTCCAGATAGAAGAAAGATGG - Intergenic
976484268 4:85583280-85583302 CTTTCCAGGAAGATGAAAAAGGG + Intronic
977146313 4:93445142-93445164 CATTCCAGCCAGAAGAAAGGAGG - Intronic
977860191 4:101948586-101948608 CATTTTAGATAGAAGAAAAAGGG - Intronic
978921206 4:114184576-114184598 CATTCCAGGCAGAGGAAAGTAGG - Intergenic
980658532 4:135824366-135824388 CATTCTAGGTATCAGAATGAAGG - Intergenic
981767369 4:148266480-148266502 CATTCCAGAGAGAAAAATGAGGG + Intronic
983273073 4:165586238-165586260 CATTTCAGACAGAACAAAGATGG + Intergenic
983796502 4:171870312-171870334 CATTCCAGCAAACAGAAAGAAGG - Intronic
985225674 4:187759226-187759248 AAAGCCAGTTAGAAGAAAGAAGG - Intergenic
985336493 4:188902146-188902168 AATTCCATGTAGATTAAAGAAGG - Intergenic
986683952 5:10259620-10259642 CATTCCAGGCTGAGGACAGATGG + Intronic
988356293 5:30180071-30180093 CATCCCTGGTAGAAGGATGAAGG + Intergenic
989081676 5:37629382-37629404 CATTCCAGATGGAAAAAAGAAGG - Intronic
989431696 5:41362791-41362813 TAGTCCAGGAAGAAGAAATAAGG + Intronic
989539098 5:42598125-42598147 CATTCCTGGTAGAGGAAGCAAGG + Intronic
989566991 5:42910675-42910697 CAAACCAGTTAGAAGGAAGATGG - Intergenic
989604430 5:43230336-43230358 CATTCTAGCTAGCAGGAAGATGG + Intronic
990006636 5:50952588-50952610 CATTTCAGGTAGGAGGAAGTGGG + Intergenic
990088093 5:52003908-52003930 TCTTCAAGGGAGAAGAAAGAAGG - Intergenic
990327719 5:54694609-54694631 CATTCCAGGCAGAAGGAGGAGGG + Intergenic
990681518 5:58249884-58249906 CATTCCACATAGCAGGAAGAAGG + Intergenic
990733584 5:58835542-58835564 AAATCCAGGTAGAAAAATGAGGG - Intronic
990756198 5:59073392-59073414 CATTCCAGGCTGATAAAAGAGGG + Intronic
990866462 5:60385792-60385814 TATTCCAGGTAGATGAAAATAGG - Intronic
990979326 5:61587594-61587616 AATTCCATTTACAAGAAAGACGG + Intergenic
991122149 5:63029043-63029065 CAATCCTAGTAAAAGAAAGAGGG + Intergenic
992191275 5:74294449-74294471 CATTGGAGGTAGATGACAGATGG - Intergenic
992195315 5:74333454-74333476 CATTCCAGGCAGAAGGAACAGGG - Intergenic
992681071 5:79153745-79153767 CATTCCAGGAAGAGATAAGAAGG + Intronic
993053410 5:82952056-82952078 TATCCCAGGTTGAAGAAATATGG + Intergenic
993087142 5:83377171-83377193 CTTTGCAGGTGGAAGAAACATGG + Intergenic
993523360 5:88933504-88933526 CTGTCCAGGTAGAAGAATAAAGG - Intergenic
994446783 5:99885604-99885626 TTTTCAAGTTAGAAGAAAGATGG - Intergenic
995346556 5:111126792-111126814 CATCCCAGGTGGAAGAAAACTGG + Exonic
995532629 5:113106434-113106456 TATTCCAGGGGGAAAAAAGAAGG - Intronic
995647187 5:114326291-114326313 CATTCCAGGTTGAGGAAACATGG + Intergenic
995931803 5:117455260-117455282 CATTGCAGCTTGAAGATAGACGG - Intergenic
999001274 5:147925653-147925675 CATTCCAAGTGGAAAAAACAAGG + Intergenic
999196345 5:149784126-149784148 CAACCCAAGTAGAAGAAAGAAGG - Intronic
999817789 5:155195028-155195050 CATTCCAGGCAGCAGGAAGGAGG - Intergenic
1000109512 5:158094496-158094518 CATTCCAGGCAGATAAAAGCAGG - Intergenic
1000546704 5:162611337-162611359 CATGGCAGGAACAAGAAAGATGG - Intergenic
1001950791 5:175815129-175815151 CATTCAGGGTAGGAGAAAGGAGG - Intronic
1003151042 6:3549151-3549173 CATTCCAAGTGGGAGAAAGTTGG + Intergenic
1003432924 6:6056521-6056543 CATTCCTGGCAGAAGAAACATGG - Intergenic
1003442349 6:6154933-6154955 CATACCATGGAGAAGACAGATGG - Intronic
1003491204 6:6623492-6623514 CAGTCAAGGTAGCAGAGAGATGG - Intronic
1004147564 6:13082466-13082488 CAGTTCAGGAAGAAGAAAAATGG + Intronic
1004266968 6:14157179-14157201 CCTTTCAGAAAGAAGAAAGAAGG - Intergenic
1004521797 6:16367859-16367881 CATTCCAGAAAGCAGAAAGGAGG - Intronic
1004848011 6:19667227-19667249 CATTCAAGGGAGGAGTAAGAAGG - Intergenic
1005030036 6:21499993-21500015 CATTCCAGCTAGAAAAAAAAGGG + Intergenic
1005396942 6:25392566-25392588 CAGTCCAGGAAGAAGCAAGCAGG - Intronic
1005782800 6:29210780-29210802 CATTGCAGGTAGGATAATGAGGG - Intergenic
1005977957 6:30814605-30814627 CATTCCAGGCAGAAAGGAGAAGG - Intergenic
1006140043 6:31923043-31923065 CACTCCAGGTAGAGGGAAGCAGG - Intronic
1007033682 6:38653071-38653093 CATTCCACTTAGAAAAAAGAAGG + Intergenic
1007723236 6:43898500-43898522 CATTCCAGCCAGAGGGAAGAGGG - Intergenic
1008185234 6:48381228-48381250 CATTACATGTAAAAGAAAAAGGG + Intergenic
1008358205 6:50581204-50581226 CATTCCAGGCAGGAGAACGGAGG - Intergenic
1008423232 6:51327321-51327343 CTTACCAAGTAGAAGAAAAATGG - Intergenic
1009676377 6:66827920-66827942 CATTCCAGAGAGAGGAAATAGGG - Intergenic
1009752314 6:67888582-67888604 CAAGCCAGACAGAAGAAAGAGGG + Intergenic
1009964495 6:70564524-70564546 CAGTCATGGCAGAAGAAAGACGG + Intergenic
1011013185 6:82724930-82724952 AATCCCAGGTACAAGAAATATGG + Intergenic
1011041481 6:83034365-83034387 CACTGCAGGAAGAAGAAAAAAGG - Intronic
1011191911 6:84738346-84738368 CATACCATGCAGAAGACAGATGG + Intronic
1011997062 6:93604397-93604419 CATTCAATGTAGAAGAGAGTAGG + Intergenic
1012926741 6:105274966-105274988 TATTCCAGGGAGGAGACAGATGG - Intergenic
1013142976 6:107358539-107358561 CATTCTATGGAGAATAAAGATGG + Intronic
1014076185 6:117237091-117237113 CATTTAAGGTAGATGAAAGATGG + Intergenic
1014268457 6:119309592-119309614 CATTCCACGTAGAAGTAAAATGG + Intronic
1015739259 6:136435711-136435733 GTTTCCAAGTAGAGGAAAGAAGG + Intronic
1015827922 6:137335445-137335467 CATGTTAGGTTGAAGAAAGATGG - Intergenic
1016385316 6:143525180-143525202 CATCCCAGGAAGAAAATAGAAGG + Intergenic
1016684285 6:146863839-146863861 CAATCCAGGGAGGAGAAAGCAGG - Intergenic
1017490510 6:154940824-154940846 GATTCCAGGCAGGAGAAAAAAGG - Intronic
1017990271 6:159481607-159481629 CATTTCAGAAAGAGGAAAGATGG - Intergenic
1017996426 6:159535255-159535277 TAATGCAGGTGGAAGAAAGAGGG + Intergenic
1018993379 6:168691921-168691943 CATTCCAGGCAGAAGGAAACTGG - Intergenic
1019792904 7:3028902-3028924 GATTCAAGGTGAAAGAAAGAGGG + Intronic
1020804810 7:12776097-12776119 TATTCTAGGCAGAAAAAAGAAGG + Intergenic
1021009055 7:15439451-15439473 GATTCAAGGTAGCAGAAAGAAGG - Intronic
1021372636 7:19868831-19868853 CATTCCAGAAAGTAGAAAGAGGG + Intergenic
1021535513 7:21700224-21700246 GAGTACAGGTAGAACAAAGAAGG + Intronic
1021540938 7:21757428-21757450 CATGCCAAGATGAAGAAAGAAGG - Intronic
1021830951 7:24609264-24609286 CATTCCAGGTAGAAGGCTGGTGG - Intronic
1022204497 7:28150237-28150259 CATTCAAGGAAGTAGAAACAGGG + Intronic
1022409611 7:30128815-30128837 CACTCAAGGTGGAAGACAGAAGG + Intronic
1023209286 7:37785751-37785773 GATTCCAGATAGCAAAAAGAAGG + Intronic
1024542697 7:50491909-50491931 CATTCCTGGAAGAATAAACATGG - Intronic
1026192296 7:68140435-68140457 CATTCCAGGAAGAAAATAGCGGG - Intergenic
1026332926 7:69368716-69368738 CTTTCAAGGCAGAAGAAAGAAGG + Intergenic
1026504585 7:70971381-70971403 ATTTCCAAATAGAAGAAAGAAGG - Intergenic
1027381936 7:77620436-77620458 CATTACATGAAGAAGAAAAAAGG - Intronic
1027669961 7:81084305-81084327 TATTTGAGTTAGAAGAAAGATGG + Intergenic
1027700850 7:81468632-81468654 TTTTCCAGGTAGGAGGAAGAAGG + Intergenic
1028264760 7:88709350-88709372 CATTCTAGGAAAAAGAGAGAGGG + Intergenic
1030003718 7:105094291-105094313 AATACTAGGTAGAATAAAGATGG + Intronic
1030847250 7:114435348-114435370 AATTCTAGGTAGAAGGAAAAGGG + Intronic
1031304073 7:120102036-120102058 ACTTCCAGGGAGAAGAAAGACGG - Intergenic
1032596022 7:133241372-133241394 CCTTCCAGGTAGGAGAGACAGGG - Intergenic
1032876053 7:136039235-136039257 CAATCCAGGGAAAAGAAAGCAGG + Intergenic
1033595744 7:142856598-142856620 CACTCTAGGTAGAAGGAGGATGG + Intronic
1034240432 7:149606516-149606538 CCTCCCAGGCAGCAGAAAGATGG - Intergenic
1034470147 7:151250499-151250521 CATTCCAGGTAAAAGAATCGGGG - Intronic
1035100500 7:156392333-156392355 CATTCCAGGGAGGAGGAAGCTGG + Intergenic
1035107237 7:156452102-156452124 CATTCCAGGCAGAGGGAACAAGG - Intergenic
1036489211 8:9209292-9209314 CATTCCAGAAACAGGAAAGATGG + Intergenic
1036577894 8:10045391-10045413 AATCCCAGGGAGAAGAAAGAAGG + Intergenic
1037358195 8:18045342-18045364 CATGCCATGGAGCAGAAAGAGGG - Intergenic
1037438377 8:18888869-18888891 AATTCCAGGCATAAGGAAGAGGG - Intronic
1037496386 8:19444915-19444937 AATTCCAGATGGAAGAAATAGGG + Intronic
1037552971 8:19992920-19992942 GTTTCCAGGTAGAAGCAACAGGG - Intergenic
1037619086 8:20547217-20547239 CATTCCAAATAGAAGCAAGAGGG + Intergenic
1038236682 8:25765543-25765565 CATGGCAGTTATAAGAAAGAAGG - Intergenic
1038390146 8:27190062-27190084 CATTCAATGTGGAAAAAAGAAGG + Intergenic
1039280238 8:35976693-35976715 CTATGAAGGTAGAAGAAAGAGGG + Intergenic
1039534503 8:38295901-38295923 CATTCCGGGTGGAAGGAAGCTGG + Exonic
1039810892 8:41047473-41047495 CATGGCAGGTAGAAGAAATCTGG + Intergenic
1041685000 8:60635839-60635861 CAACACAGGCAGAAGAAAGAAGG - Intergenic
1041846020 8:62330113-62330135 GATTCCAGATAGAAGAGAAAGGG + Intronic
1043192250 8:77240504-77240526 CATTCCAGATGGAATAAAGCAGG - Intergenic
1043580071 8:81701961-81701983 TATTCCATAGAGAAGAAAGATGG - Exonic
1043653522 8:82631334-82631356 CAAACCAGTTGGAAGAAAGAAGG - Intergenic
1043912166 8:85875693-85875715 CATCCCAGGTAGTGGGAAGAGGG - Intergenic
1045919882 8:107517482-107517504 CATTCCTGGTAGGATAAGGAGGG - Intergenic
1046711346 8:117515240-117515262 CATCCCAGCTAGTAGGAAGAAGG + Intergenic
1046849864 8:118960089-118960111 GATTCCAGGCAGGAGAAACAAGG + Intergenic
1047517094 8:125564426-125564448 CATTCCAGGTAGCAAGAAGGAGG + Intergenic
1048000745 8:130377666-130377688 GAATCCAGGTAGAAGCCAGAGGG - Intronic
1048375324 8:133818064-133818086 CTTTCCAGGAAGAGGAAACAGGG - Intergenic
1048488574 8:134870936-134870958 CATTCCAGACAGAAAGAAGAAGG + Intergenic
1048598716 8:135895549-135895571 CATTCCAAGTAGAAGGAGGAAGG - Intergenic
1049137851 8:140921224-140921246 CATTCAGGGAAGGAGAAAGAGGG + Intronic
1051325576 9:15963988-15964010 CATTCTAGCGAGAAGAAAGGAGG - Intronic
1051985566 9:23082432-23082454 CATTCCATAGAGAAGAAAAAGGG - Intergenic
1054775753 9:69122117-69122139 CAGGCCAGGGAGAAGAAAAAAGG - Intronic
1055401173 9:75925681-75925703 CATTTCAGGCAGAAGGAAGGAGG + Intronic
1056189891 9:84174578-84174600 CATTCCAGCCAGCAGAAAGGAGG + Intergenic
1057057607 9:91975872-91975894 TATCCCAGGTAGGACAAAGAAGG + Intergenic
1057895085 9:98902944-98902966 CATAGAAGATAGAAGAAAGAAGG - Intergenic
1058100731 9:100915466-100915488 CATTCCAGAAAGAAGTATGAGGG - Intergenic
1059493968 9:114694290-114694312 CATTCCAGCTAGCAGGAAGGAGG - Intergenic
1060542848 9:124442567-124442589 CATTCAAGGCAGAAGGAAGAGGG + Intergenic
1061112064 9:128580647-128580669 ACTCCCAGGTAGAAGAAATAGGG - Intronic
1061605759 9:131709577-131709599 CTTTCCAGGAAGAAGCAAGGAGG - Intronic
1061865544 9:133490278-133490300 GATTCCAGGCAGGAAAAAGAGGG - Intergenic
1185787540 X:2903562-2903584 CATTCCAGGCAGCAAAAAGGAGG - Intergenic
1185787686 X:2904575-2904597 CATTCCAGGCAGCAGGAAAAAGG - Exonic
1185844348 X:3423573-3423595 CTTTCCATACAGAAGAAAGAAGG - Intergenic
1186227392 X:7414402-7414424 CACTCCAGGTAGGAGCAAAATGG + Intergenic
1187408893 X:19029949-19029971 CGTTCCAGGTAGAATATAGGAGG - Intronic
1188612368 X:32116185-32116207 CATTCCAGGCAGAGGAAACAAGG - Intronic
1188639968 X:32488920-32488942 GATTCCAGGCAGAAGGAACATGG - Intronic
1189373520 X:40448490-40448512 CATTCCAGCCAGAAGAATGGAGG - Intergenic
1189648655 X:43164061-43164083 CCTTCCTGGAAAAAGAAAGAAGG - Intergenic
1190006458 X:46744152-46744174 CATTCCAGGAAGCAGACAGAAGG + Intronic
1192074539 X:67979432-67979454 AATTCCAGGTAGAAAAAACCTGG - Intergenic
1192792933 X:74400919-74400941 CATTTCAGGAAGAAAAATGAAGG + Intergenic
1195068879 X:101260969-101260991 AATTCCACGGAGAAGGAAGAGGG - Exonic
1195501586 X:105607674-105607696 CATTCCAGTTAGAAGAAACATGG + Intronic
1195700939 X:107705173-107705195 GATTTCAGGTAGAAGAAAATAGG - Intergenic
1196623064 X:117846212-117846234 CTTTCCAGGCAGCAGAAAGGAGG - Intergenic
1196802890 X:119559402-119559424 CATTCCAGGTGGAAGGAATATGG - Intronic
1198208357 X:134491585-134491607 CATTTCAGGTACGAGAAATAAGG - Intronic
1198656983 X:138925407-138925429 CATTTCCAGTTGAAGAAAGAAGG + Intronic
1199304513 X:146251699-146251721 CAGTGCAGTTAGAAGAAAGCAGG + Intergenic
1199507094 X:148575602-148575624 TATTCAGGGAAGAAGAAAGAAGG - Intronic
1199671514 X:150152008-150152030 GAGACCAAGTAGAAGAAAGAAGG - Intergenic
1201688609 Y:16736432-16736454 CATACAAGCTAGAAGAAAGTGGG - Intergenic
1201918147 Y:19204769-19204791 CATGGCAGGCAGGAGAAAGAAGG + Intergenic
1201953611 Y:19594843-19594865 CATTCCAAGGAAAAAAAAGAGGG - Intergenic