ID: 924801460

View in Genome Browser
Species Human (GRCh38)
Location 1:247331830-247331852
Sequence CGTCCGGCGGGCTCCCGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 89}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924801460_924801473 21 Left 924801460 1:247331830-247331852 CCGCCGCGGGAGCCCGCCGGACG 0: 1
1: 0
2: 0
3: 8
4: 89
Right 924801473 1:247331874-247331896 GCCCTCCGGCTCCCTCCCCTGGG 0: 1
1: 0
2: 2
3: 33
4: 428
924801460_924801467 -7 Left 924801460 1:247331830-247331852 CCGCCGCGGGAGCCCGCCGGACG 0: 1
1: 0
2: 0
3: 8
4: 89
Right 924801467 1:247331846-247331868 CCGGACGCCGAGGAAAGGAAAGG 0: 1
1: 0
2: 0
3: 4
4: 85
924801460_924801470 7 Left 924801460 1:247331830-247331852 CCGCCGCGGGAGCCCGCCGGACG 0: 1
1: 0
2: 0
3: 8
4: 89
Right 924801470 1:247331860-247331882 AAGGAAAGGCCGGAGCCCTCCGG 0: 1
1: 1
2: 3
3: 14
4: 154
924801460_924801468 -3 Left 924801460 1:247331830-247331852 CCGCCGCGGGAGCCCGCCGGACG 0: 1
1: 0
2: 0
3: 8
4: 89
Right 924801468 1:247331850-247331872 ACGCCGAGGAAAGGAAAGGCCGG 0: 1
1: 0
2: 0
3: 16
4: 204
924801460_924801472 20 Left 924801460 1:247331830-247331852 CCGCCGCGGGAGCCCGCCGGACG 0: 1
1: 0
2: 0
3: 8
4: 89
Right 924801472 1:247331873-247331895 AGCCCTCCGGCTCCCTCCCCTGG 0: 1
1: 0
2: 2
3: 54
4: 383

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924801460 Original CRISPR CGTCCGGCGGGCTCCCGCGG CGG (reversed) Intronic