ID: 924801516

View in Genome Browser
Species Human (GRCh38)
Location 1:247332007-247332029
Sequence GCCCCGCTCCGCGCGCGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924801504_924801516 22 Left 924801504 1:247331962-247331984 CCGGCCGAGGTGTGCGCTGGGGG No data
Right 924801516 1:247332007-247332029 GCCCCGCTCCGCGCGCGCCTGGG No data
924801506_924801516 18 Left 924801506 1:247331966-247331988 CCGAGGTGTGCGCTGGGGGTGAC No data
Right 924801516 1:247332007-247332029 GCCCCGCTCCGCGCGCGCCTGGG No data
924801502_924801516 23 Left 924801502 1:247331961-247331983 CCCGGCCGAGGTGTGCGCTGGGG No data
Right 924801516 1:247332007-247332029 GCCCCGCTCCGCGCGCGCCTGGG No data
924801497_924801516 26 Left 924801497 1:247331958-247331980 CCCCCCGGCCGAGGTGTGCGCTG No data
Right 924801516 1:247332007-247332029 GCCCCGCTCCGCGCGCGCCTGGG No data
924801508_924801516 -7 Left 924801508 1:247331991-247332013 CCGACACCCCCGGCCCGCCCCGC No data
Right 924801516 1:247332007-247332029 GCCCCGCTCCGCGCGCGCCTGGG No data
924801496_924801516 29 Left 924801496 1:247331955-247331977 CCGCCCCCCGGCCGAGGTGTGCG No data
Right 924801516 1:247332007-247332029 GCCCCGCTCCGCGCGCGCCTGGG No data
924801500_924801516 24 Left 924801500 1:247331960-247331982 CCCCGGCCGAGGTGTGCGCTGGG No data
Right 924801516 1:247332007-247332029 GCCCCGCTCCGCGCGCGCCTGGG No data
924801498_924801516 25 Left 924801498 1:247331959-247331981 CCCCCGGCCGAGGTGTGCGCTGG No data
Right 924801516 1:247332007-247332029 GCCCCGCTCCGCGCGCGCCTGGG No data
924801495_924801516 30 Left 924801495 1:247331954-247331976 CCCGCCCCCCGGCCGAGGTGTGC No data
Right 924801516 1:247332007-247332029 GCCCCGCTCCGCGCGCGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924801516 Original CRISPR GCCCCGCTCCGCGCGCGCCT GGG Intergenic