ID: 924804975

View in Genome Browser
Species Human (GRCh38)
Location 1:247354772-247354794
Sequence CAACCCTCGAACCAGGGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924804968_924804975 19 Left 924804968 1:247354730-247354752 CCTGGATAGTCCTTTGGGGAGAT No data
Right 924804975 1:247354772-247354794 CAACCCTCGAACCAGGGACAAGG No data
924804966_924804975 21 Left 924804966 1:247354728-247354750 CCCCTGGATAGTCCTTTGGGGAG No data
Right 924804975 1:247354772-247354794 CAACCCTCGAACCAGGGACAAGG No data
924804970_924804975 9 Left 924804970 1:247354740-247354762 CCTTTGGGGAGATTGTTGCAGGT No data
Right 924804975 1:247354772-247354794 CAACCCTCGAACCAGGGACAAGG No data
924804967_924804975 20 Left 924804967 1:247354729-247354751 CCCTGGATAGTCCTTTGGGGAGA No data
Right 924804975 1:247354772-247354794 CAACCCTCGAACCAGGGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924804975 Original CRISPR CAACCCTCGAACCAGGGACA AGG Intergenic
No off target data available for this crispr