ID: 924808620

View in Genome Browser
Species Human (GRCh38)
Location 1:247381721-247381743
Sequence TGGGACTTCTTGGGAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924808620_924808627 0 Left 924808620 1:247381721-247381743 CCTGTTTTTCCCAAGAAGTCCCA No data
Right 924808627 1:247381744-247381766 GGCTACCAGAAGTCATCTCAGGG No data
924808620_924808630 25 Left 924808620 1:247381721-247381743 CCTGTTTTTCCCAAGAAGTCCCA No data
Right 924808630 1:247381769-247381791 TCTCATGTGTGCATTAAGATTGG No data
924808620_924808626 -1 Left 924808620 1:247381721-247381743 CCTGTTTTTCCCAAGAAGTCCCA No data
Right 924808626 1:247381743-247381765 AGGCTACCAGAAGTCATCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924808620 Original CRISPR TGGGACTTCTTGGGAAAAAC AGG (reversed) Intergenic
No off target data available for this crispr