ID: 924808626

View in Genome Browser
Species Human (GRCh38)
Location 1:247381743-247381765
Sequence AGGCTACCAGAAGTCATCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924808620_924808626 -1 Left 924808620 1:247381721-247381743 CCTGTTTTTCCCAAGAAGTCCCA No data
Right 924808626 1:247381743-247381765 AGGCTACCAGAAGTCATCTCAGG No data
924808622_924808626 -10 Left 924808622 1:247381730-247381752 CCCAAGAAGTCCCAGGCTACCAG No data
Right 924808626 1:247381743-247381765 AGGCTACCAGAAGTCATCTCAGG No data
924808619_924808626 22 Left 924808619 1:247381698-247381720 CCAAAATGGGGTTGGTGGTGCTT No data
Right 924808626 1:247381743-247381765 AGGCTACCAGAAGTCATCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924808626 Original CRISPR AGGCTACCAGAAGTCATCTC AGG Intergenic
No off target data available for this crispr