ID: 924808627

View in Genome Browser
Species Human (GRCh38)
Location 1:247381744-247381766
Sequence GGCTACCAGAAGTCATCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924808619_924808627 23 Left 924808619 1:247381698-247381720 CCAAAATGGGGTTGGTGGTGCTT No data
Right 924808627 1:247381744-247381766 GGCTACCAGAAGTCATCTCAGGG No data
924808623_924808627 -10 Left 924808623 1:247381731-247381753 CCAAGAAGTCCCAGGCTACCAGA No data
Right 924808627 1:247381744-247381766 GGCTACCAGAAGTCATCTCAGGG No data
924808622_924808627 -9 Left 924808622 1:247381730-247381752 CCCAAGAAGTCCCAGGCTACCAG No data
Right 924808627 1:247381744-247381766 GGCTACCAGAAGTCATCTCAGGG No data
924808620_924808627 0 Left 924808620 1:247381721-247381743 CCTGTTTTTCCCAAGAAGTCCCA No data
Right 924808627 1:247381744-247381766 GGCTACCAGAAGTCATCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924808627 Original CRISPR GGCTACCAGAAGTCATCTCA GGG Intergenic
No off target data available for this crispr