ID: 924808630

View in Genome Browser
Species Human (GRCh38)
Location 1:247381769-247381791
Sequence TCTCATGTGTGCATTAAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924808623_924808630 15 Left 924808623 1:247381731-247381753 CCAAGAAGTCCCAGGCTACCAGA No data
Right 924808630 1:247381769-247381791 TCTCATGTGTGCATTAAGATTGG No data
924808622_924808630 16 Left 924808622 1:247381730-247381752 CCCAAGAAGTCCCAGGCTACCAG No data
Right 924808630 1:247381769-247381791 TCTCATGTGTGCATTAAGATTGG No data
924808620_924808630 25 Left 924808620 1:247381721-247381743 CCTGTTTTTCCCAAGAAGTCCCA No data
Right 924808630 1:247381769-247381791 TCTCATGTGTGCATTAAGATTGG No data
924808625_924808630 5 Left 924808625 1:247381741-247381763 CCAGGCTACCAGAAGTCATCTCA No data
Right 924808630 1:247381769-247381791 TCTCATGTGTGCATTAAGATTGG No data
924808624_924808630 6 Left 924808624 1:247381740-247381762 CCCAGGCTACCAGAAGTCATCTC No data
Right 924808630 1:247381769-247381791 TCTCATGTGTGCATTAAGATTGG No data
924808628_924808630 -3 Left 924808628 1:247381749-247381771 CCAGAAGTCATCTCAGGGCCTCT No data
Right 924808630 1:247381769-247381791 TCTCATGTGTGCATTAAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924808630 Original CRISPR TCTCATGTGTGCATTAAGAT TGG Intergenic
No off target data available for this crispr