ID: 924810956

View in Genome Browser
Species Human (GRCh38)
Location 1:247401653-247401675
Sequence AATAAAACTATTAGTTTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924810956_924810958 21 Left 924810956 1:247401653-247401675 CCTTTAAAACTAATAGTTTTATT No data
Right 924810958 1:247401697-247401719 CCTCCCAAATCCCCAGCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924810956 Original CRISPR AATAAAACTATTAGTTTTAA AGG (reversed) Intergenic
No off target data available for this crispr