ID: 924812241

View in Genome Browser
Species Human (GRCh38)
Location 1:247413336-247413358
Sequence GGTACCACCTCAAACCTGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924812241_924812244 -8 Left 924812241 1:247413336-247413358 CCTAACAGGTTTGAGGTGGTACC No data
Right 924812244 1:247413351-247413373 GTGGTACCTCATTGTGGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924812241 Original CRISPR GGTACCACCTCAAACCTGTT AGG (reversed) Intergenic
No off target data available for this crispr