ID: 924813674

View in Genome Browser
Species Human (GRCh38)
Location 1:247424707-247424729
Sequence CTGAAACAGCAGATGGAGAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 416
Summary {0: 1, 1: 1, 2: 5, 3: 34, 4: 375}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924813671_924813674 5 Left 924813671 1:247424679-247424701 CCTGGTCTGCTGGATCGTGTGCA 0: 1
1: 0
2: 0
3: 5
4: 105
Right 924813674 1:247424707-247424729 CTGAAACAGCAGATGGAGAGTGG 0: 1
1: 1
2: 5
3: 34
4: 375
924813668_924813674 8 Left 924813668 1:247424676-247424698 CCCCCTGGTCTGCTGGATCGTGT 0: 1
1: 0
2: 1
3: 17
4: 105
Right 924813674 1:247424707-247424729 CTGAAACAGCAGATGGAGAGTGG 0: 1
1: 1
2: 5
3: 34
4: 375
924813670_924813674 6 Left 924813670 1:247424678-247424700 CCCTGGTCTGCTGGATCGTGTGC 0: 1
1: 0
2: 3
3: 8
4: 110
Right 924813674 1:247424707-247424729 CTGAAACAGCAGATGGAGAGTGG 0: 1
1: 1
2: 5
3: 34
4: 375
924813666_924813674 21 Left 924813666 1:247424663-247424685 CCATGTGCTTCATCCCCCTGGTC 0: 1
1: 0
2: 2
3: 22
4: 250
Right 924813674 1:247424707-247424729 CTGAAACAGCAGATGGAGAGTGG 0: 1
1: 1
2: 5
3: 34
4: 375
924813669_924813674 7 Left 924813669 1:247424677-247424699 CCCCTGGTCTGCTGGATCGTGTG 0: 1
1: 0
2: 0
3: 9
4: 110
Right 924813674 1:247424707-247424729 CTGAAACAGCAGATGGAGAGTGG 0: 1
1: 1
2: 5
3: 34
4: 375
924813664_924813674 29 Left 924813664 1:247424655-247424677 CCTCTTCACCATGTGCTTCATCC 0: 1
1: 0
2: 0
3: 16
4: 257
Right 924813674 1:247424707-247424729 CTGAAACAGCAGATGGAGAGTGG 0: 1
1: 1
2: 5
3: 34
4: 375

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924813674 Original CRISPR CTGAAACAGCAGATGGAGAG TGG Exonic
900350921 1:2234176-2234198 GGGAAACAGCAGCTCGAGAGTGG + Intronic
900638322 1:3676302-3676324 GAGAAACAGGAGATGGGGAGGGG + Intronic
902654614 1:17858954-17858976 CTGAGTCTGCAGATGGAGTGAGG - Intergenic
903556581 1:24198044-24198066 GTCACACAGCAGATGGAGACAGG - Intergenic
905036931 1:34924767-34924789 CTGAAACAGCAAAAGGGGAGAGG + Intronic
905592804 1:39179308-39179330 CAGAAACAGAAGATGCAGAAGGG - Intronic
907119726 1:51997941-51997963 CGTAAACAGCAGCTGGTGAGAGG - Intergenic
907466438 1:54640882-54640904 CTGAAGCAGCAGAAGGAGACTGG + Intergenic
907902128 1:58750637-58750659 CTGAGAAAGCAGAAGGGGAGGGG - Intergenic
908263479 1:62356662-62356684 CTGAAACAGGAGAAGGGCAGGGG + Intergenic
908318744 1:62960630-62960652 CTCCAACAGAAGTTGGAGAGTGG + Intergenic
910768116 1:90802941-90802963 CTCAACCATCAGGTGGAGAGTGG + Intergenic
911122233 1:94308321-94308343 CTGAAGCAGCGGATGGGGAAGGG - Intergenic
913334712 1:117698594-117698616 CCGAAGCAGCAGCAGGAGAGAGG + Intergenic
913603030 1:120440189-120440211 CTCCAACACCACATGGAGAGGGG - Intergenic
913603778 1:120446541-120446563 CTCCAACACCACATGGAGAGGGG - Intergenic
913609614 1:120497271-120497293 CTGCAACAGCAGCTGGAGAGCGG - Intergenic
913640644 1:120809258-120809280 CTCCAACACCACATGGAGAGGGG - Intronic
913985854 1:143565430-143565452 CTGCGACAGCAGCTGGATAGCGG + Intergenic
914211881 1:145587366-145587388 CTCCAACACCACATGGAGAGGGG + Intergenic
914277835 1:146141087-146141109 CTCCAACACCACATGGAGAGGGG + Intronic
914364210 1:146963804-146963826 CTCCAACACCACATGGAGAGGGG - Intronic
914538880 1:148592035-148592057 CTCCAACACCACATGGAGAGGGG + Intronic
914581576 1:149024573-149024595 CTGCAACAGCAGCTGGAGAGCGG + Exonic
914587816 1:149078486-149078508 CTCCAACACCACATGGAGAGGGG + Intronic
914627799 1:149479589-149479611 CTCCAACACCACATGGAGAGGGG - Intergenic
915246005 1:154556808-154556830 CAGAAAGAGCAGCTGGATAGGGG + Intronic
915828842 1:159106122-159106144 CTGAGACTGCAGGGGGAGAGGGG + Intronic
916648606 1:166814627-166814649 ACTAAACAGAAGATGGAGAGTGG + Intergenic
917334870 1:173916505-173916527 CTGAAGAAGCAGAGAGAGAGAGG + Intronic
918594926 1:186282083-186282105 CTCAAAGAGCATATGGAAAGAGG - Intergenic
919295702 1:195697516-195697538 CTCAAACAGCATATGGAAAGTGG + Intergenic
920676086 1:208039706-208039728 ATCAAGCAGCAGATGGAGAAGGG - Exonic
920975324 1:210780495-210780517 GTGGAACAGCAGATGCAGTGGGG + Intronic
921260345 1:213380839-213380861 CTGAGACATGAGAGGGAGAGAGG - Intergenic
922101658 1:222482159-222482181 CCCAAGGAGCAGATGGAGAGAGG - Intergenic
923456727 1:234171165-234171187 CTGAATCAGAAGCTGGAGTGGGG + Intronic
923639235 1:235736917-235736939 GTGAAACAGCACATTCAGAGAGG - Intronic
924546481 1:245032396-245032418 ATGAAACAGAAGATGGCGATGGG - Intronic
924813674 1:247424707-247424729 CTGAAACAGCAGATGGAGAGTGG + Exonic
1063132507 10:3190328-3190350 CTGTATCAGCAGATGGAACGTGG + Intergenic
1063391562 10:5652969-5652991 CTGCAACAGCTGATCGAGAGCGG - Exonic
1063963642 10:11327865-11327887 CTTTAATAGCAGATGGATAGAGG + Intronic
1064039685 10:11949376-11949398 CTGAAACTGAACATGAAGAGTGG - Intronic
1065454862 10:25896524-25896546 CTGAAACAGCAGATCGACAATGG - Intergenic
1065791187 10:29262424-29262446 GTGAAAAGGCAGATGGAGAAAGG - Intergenic
1066680225 10:37930977-37930999 CTGTGACAGCTGATGGAGAAGGG - Intergenic
1066756529 10:38717654-38717676 CAGAGGCAGCAGGTGGAGAGTGG + Intergenic
1067224875 10:44369086-44369108 AGGAAACAGGAGGTGGAGAGAGG + Intergenic
1067407426 10:46036000-46036022 AGGAAACAGCAGAGAGAGAGAGG + Intronic
1067709548 10:48637178-48637200 CTGAAGCTGCAGATGGAGACAGG + Intronic
1067819963 10:49519888-49519910 CTGAGGCAGCAGGTGCAGAGTGG - Intronic
1069185430 10:65416998-65417020 GTGGAACAGCATATGCAGAGAGG - Intergenic
1069592986 10:69653215-69653237 CTCAACTAGAAGATGGAGAGAGG + Intergenic
1072230707 10:93411894-93411916 CTGAAAAAGCAGATCGGGGGAGG - Intronic
1072396627 10:95049756-95049778 CTGAGACAGCAGCTGGGGATGGG + Intronic
1073096198 10:100981175-100981197 CTGATACAGGACATAGAGAGAGG + Exonic
1074257921 10:111821874-111821896 CTGGTACAGGAGAGGGAGAGAGG - Intergenic
1075653695 10:124147269-124147291 CTGCAAAAGCAGGTAGAGAGAGG - Intergenic
1076352262 10:129825369-129825391 CTGCAGCAGCAGAGGGAGGGAGG + Intergenic
1076546897 10:131251341-131251363 AGGAAGCAGCAGAGGGAGAGGGG - Intronic
1077958104 11:7043161-7043183 CTGAAGCAGCAAATGGAGAAGGG + Exonic
1078032090 11:7763007-7763029 ATGATAAACCAGATGGAGAGAGG - Intergenic
1078050361 11:7960500-7960522 CTGCAGGGGCAGATGGAGAGAGG - Exonic
1078427778 11:11265594-11265616 ATCTGACAGCAGATGGAGAGGGG + Intergenic
1078609741 11:12809906-12809928 CTGGACCAGCCGATGGGGAGTGG + Intronic
1080593384 11:33744320-33744342 CACAAACAGCAGATGCAGAGAGG + Intronic
1081029574 11:38061701-38061723 CTGACAAAGCAGATGGAGTTGGG - Intergenic
1081061042 11:38477917-38477939 CTGAAACAGCTGGAGGTGAGTGG + Intergenic
1082887465 11:58102338-58102360 CAGAAAGAGCAGAAGGAGAAAGG - Intronic
1083022175 11:59518441-59518463 ATGATCCAGCAGATGGAGAAAGG + Intergenic
1085450711 11:76630416-76630438 CAGGAACAGCAAATGCAGAGAGG - Intergenic
1087091162 11:94274569-94274591 CTCCAGCAGCAGAAGGAGAGAGG - Intergenic
1087159636 11:94936134-94936156 CAGAAAAAGCAGAGGTAGAGGGG + Intergenic
1088478913 11:110273769-110273791 CAGAAACAGCAAATGAAGTGTGG - Intronic
1089048698 11:115526923-115526945 ATGAAACAGCACCTGGAAAGGGG + Intergenic
1089079882 11:115766725-115766747 CTGAGTCAGCAGATGGAGGGTGG - Intergenic
1089560581 11:119341257-119341279 CTGAAAAAGCAGATGGAAAGGGG + Exonic
1089615949 11:119694857-119694879 CTGAAGGAGCAGCTGGAGAGAGG - Intronic
1089875204 11:121714545-121714567 ATGAGACAGCAGGTAGAGAGAGG + Intergenic
1090075360 11:123577344-123577366 CTGCAGCGGCAGATGGAGAGAGG - Intronic
1091187761 11:133661890-133661912 CTGCCACAGCAGAGGGAGCGGGG + Intergenic
1091413648 12:261386-261408 CTGAAAGAGCAGGGGCAGAGTGG - Intronic
1093928239 12:24929975-24929997 TGGAAACAGCAGCTGGAGAATGG - Intronic
1094646419 12:32328873-32328895 TGGAAACAGGAGATGGAGGGTGG + Intronic
1095134927 12:38588871-38588893 GTGAAACAGCAAATGGAAATTGG + Intergenic
1095513201 12:42976085-42976107 GAGAAACAGCAGATGCAGAAAGG - Intergenic
1095898317 12:47302764-47302786 GAGAAACAGCAGATGCAGAAAGG + Intergenic
1096868633 12:54579543-54579565 CAAAAACAGCAGCAGGAGAGAGG + Exonic
1097984535 12:65769538-65769560 ATGATACAGCAGATGGTGAGAGG - Intergenic
1099596258 12:84670495-84670517 AAGAAACAGCGGAGGGAGAGTGG + Intergenic
1099650508 12:85421503-85421525 CTCAAATTGAAGATGGAGAGGGG - Intergenic
1100357706 12:93847130-93847152 CTGAAAGTGCAGATGTAGAATGG + Intronic
1100540663 12:95554301-95554323 CTGGAAAGGCAGAGGGAGAGAGG + Intergenic
1100769536 12:97906303-97906325 CTGAAAGAGCAGTTGGCGTGAGG - Intergenic
1100947092 12:99798043-99798065 CCAAAACAGCAGATGGAAAAGGG + Intronic
1101841451 12:108330497-108330519 CTGCCACAGCACATGGTGAGGGG + Intronic
1102869094 12:116399478-116399500 CTGCAGCTGCAGAAGGAGAGTGG - Intergenic
1104265312 12:127226800-127226822 CTGAAACACCAACTGGAGCGAGG - Intergenic
1106358249 13:29005310-29005332 CTGGCCCAGCAGCTGGAGAGGGG + Intronic
1106360761 13:29028511-29028533 CTGAAGCAGCAGAGTGAGAAAGG - Intronic
1106679601 13:31996654-31996676 CTGGAAGAGCAGATGGAAAGTGG + Intergenic
1107310707 13:39074040-39074062 CTGCAACAGCACATTGAGAAGGG - Intergenic
1107462032 13:40613523-40613545 CTCAAACTGCAGATGGGGACCGG - Intronic
1107899794 13:45000811-45000833 CCTAAACAGCAGTTGGAGATAGG + Intronic
1107918427 13:45177333-45177355 CTGAAACTGCAGATGGGAGGTGG - Intronic
1108705565 13:52982406-52982428 CTAAAAAAGCAACTGGAGAGTGG + Intergenic
1109040780 13:57333589-57333611 CTGAAACAGGAGAAGGGGATAGG + Intergenic
1109311494 13:60699717-60699739 CAGAAACAGCAGAATGAGTGGGG - Intergenic
1109888507 13:68575450-68575472 CAGAAACAAAAGATGGAGAAGGG - Intergenic
1109922719 13:69090126-69090148 ATGAGACAGAATATGGAGAGTGG + Intergenic
1110153007 13:72277466-72277488 CAGAAAGAGTAGGTGGAGAGAGG - Intergenic
1110329316 13:74252531-74252553 TTGGAAGAGCAGGTGGAGAGGGG + Intergenic
1111098033 13:83539949-83539971 GAGAAACAGCAGCTGGAAAGAGG + Intergenic
1111232890 13:85366933-85366955 CAGAAACAACAGAAGGAGACGGG - Intergenic
1113070291 13:106413909-106413931 AAGAGACAGCAGATGGAGTGGGG - Intergenic
1119951675 14:78751921-78751943 CTGAACCAGGAAATGGATAGAGG + Intronic
1120334059 14:83131026-83131048 GGGAAAGAGCAGAAGGAGAGGGG + Intergenic
1120401914 14:84043042-84043064 CTGAAAATGCAGATGGCAAGTGG - Intergenic
1120715880 14:87840293-87840315 CTGTAACTGCAGAGGGAGACTGG - Intronic
1121254410 14:92520590-92520612 CTGAAAGATAAGCTGGAGAGAGG + Intronic
1121308410 14:92922005-92922027 CAGCAGCCGCAGATGGAGAGGGG + Intergenic
1121579333 14:95015188-95015210 CTGAGTCACCACATGGAGAGCGG - Intergenic
1121943784 14:98098888-98098910 CTGGGGCAGCAGAGGGAGAGGGG + Intergenic
1122297128 14:100711991-100712013 CTGAGAGAGCACATGGAGAGGGG + Intergenic
1123574324 15:21651728-21651750 CTGAAACAGAAGAAAGAGTGTGG + Intergenic
1123610939 15:22094315-22094337 CTGAAACAGAAGAAAGAGTGTGG + Intergenic
1124129967 15:26974571-26974593 CAGAGACAGCAGAGGGAGGGAGG + Intronic
1124529192 15:30488617-30488639 CTGCAACAGGAGAACGAGAGAGG - Intergenic
1124725544 15:32152962-32152984 CTGGAACAGGGGACGGAGAGGGG + Intronic
1125923058 15:43537969-43537991 CAGAAACAGAAGAGGGAGAAGGG + Intronic
1127378001 15:58402622-58402644 CTGAAACATCAGTTGGGGTGGGG + Intronic
1127505721 15:59596136-59596158 CTGGAACAGCAGCTGGAGTCTGG - Intronic
1128892267 15:71342036-71342058 CTGTAACAGGAGATGGGGAGGGG + Intronic
1129295808 15:74599457-74599479 CTGAAGGCGCAGATGGAGGGAGG + Intronic
1129896158 15:79107579-79107601 CTGAAACAGCTGAGAGAGGGTGG - Intergenic
1130756123 15:86765466-86765488 CTGAAACACCAGCTGCAAAGTGG - Intronic
1131823427 15:96295780-96295802 CTGAGAGAGGAGGTGGAGAGAGG - Intergenic
1132425294 15:101710805-101710827 CAGAAACAAGAGAAGGAGAGGGG + Intronic
1202983188 15_KI270727v1_random:386071-386093 CTGAAACAGAAGAAAGAGTGTGG + Intergenic
1132552484 16:559289-559311 CTGAAACAGCACAGGGAGCCCGG - Intergenic
1133134330 16:3699176-3699198 CTGAGACTGCAGCTGCAGAGTGG - Intronic
1133234925 16:4383265-4383287 CGGAAAGAGCAGAGGGAGAGCGG + Exonic
1133737083 16:8624062-8624084 CTGAAGAAACAGATGCAGAGAGG + Intronic
1134872782 16:17666877-17666899 GTGTAACAACAGAAGGAGAGGGG - Intergenic
1135843289 16:25895715-25895737 CTCACACAGCAGAGGGAAAGAGG + Intronic
1138756561 16:59493511-59493533 CTGAAGCAGAAGAGGAAGAGAGG - Intergenic
1139341303 16:66269905-66269927 CTGAACCAGCAGTTAGAGAGAGG + Intergenic
1139726338 16:68902429-68902451 CTGACACAGAGAATGGAGAGAGG - Exonic
1140435466 16:74943364-74943386 CTGACATAGCTGATGGGGAGTGG - Intronic
1140723317 16:77789665-77789687 GAGAAACAGAGGATGGAGAGGGG - Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141434552 16:83992385-83992407 TTGAAACAGCAAATGGAGGTGGG - Intronic
1142217920 16:88838924-88838946 CTGAGAGAGGAGATGGGGAGAGG - Intronic
1143161750 17:4876409-4876431 CTCAAAGAGGAGCTGGAGAGCGG - Intronic
1143731208 17:8883968-8883990 ATAAAACAGCAGATGGACGGTGG - Intronic
1143844662 17:9764991-9765013 CTGAAATTGTGGATGGAGAGGGG + Intergenic
1144775686 17:17783520-17783542 CTGAAACATCTGTTGCAGAGGGG + Intronic
1145986216 17:29048703-29048725 AAGAAACAGCAGCTGCAGAGGGG - Intronic
1146542795 17:33712043-33712065 ATGTAACAGTAGATGGAGAAAGG + Intronic
1148022867 17:44565200-44565222 CTGAATCAGGAGATAGAGAGAGG + Intergenic
1149100561 17:52901446-52901468 CTGAAAAATCAGGTGTAGAGGGG - Intergenic
1149923783 17:60682329-60682351 CTGAATCAGAATAAGGAGAGTGG + Intronic
1151107318 17:71631393-71631415 CAGACACAGCATATGGATAGGGG - Intergenic
1151546762 17:74798003-74798025 CAGAAACAGCTGGTGGTGAGAGG - Intronic
1152564797 17:81095509-81095531 CTGGAACAGCAGGTGAGGAGAGG + Intronic
1155712678 18:28902803-28902825 CTGAAACAGGATTTAGAGAGGGG + Intergenic
1157411059 18:47463948-47463970 CAGAATCAGGAGAGGGAGAGTGG - Intergenic
1158161277 18:54486526-54486548 CTGAACCAGTAAATGAAGAGGGG + Intergenic
1159653289 18:71002925-71002947 CTGAAAGAAAACATGGAGAGTGG + Intergenic
1159790202 18:72769073-72769095 ATGAGACTGCTGATGGAGAGTGG + Intronic
1159863482 18:73676427-73676449 CTGAAAGAGCAGATTTTGAGGGG + Intergenic
1160145404 18:76359740-76359762 AGGAAACAGCAGATCGGGAGAGG + Exonic
1161431817 19:4236886-4236908 TAGAACCAGAAGATGGAGAGGGG - Intronic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1164820126 19:31243602-31243624 CTCAAATAGCAGAAGCAGAGGGG + Intergenic
1165134665 19:33660235-33660257 CTTAAAAAGCAGCTGTAGAGAGG - Intronic
1165153682 19:33774980-33775002 CTGAGACAGCAGATGCTGAGGGG + Intergenic
1165757232 19:38300999-38301021 CAGAGAGAGCAGAAGGAGAGAGG - Intronic
1166089898 19:40502105-40502127 CTGACACAGCAGAGGAAGGGGGG - Intronic
1166230752 19:41424827-41424849 CTGTAACAACAGGTGAAGAGGGG - Exonic
1166717491 19:44977707-44977729 CAGAAAAAGCAGCTGGAGACAGG + Intronic
1168217878 19:54939680-54939702 CTGAAGCTGCAGATGGAGAAGGG - Exonic
1168224240 19:54982920-54982942 CTGAAGCTGCAGATGGAGAAGGG + Exonic
1168367110 19:55797928-55797950 CATAAACAGGAGATGGGGAGAGG + Intronic
1168368359 19:55809543-55809565 CTGAAGCGGCAGATGGACAAGGG - Exonic
1168384940 19:55955274-55955296 CTGAAACAGCAAATGGAGAGAGG + Exonic
928006333 2:27565458-27565480 CTTAAATAGCAGGTGGAGGGAGG + Intronic
930243450 2:48959426-48959448 CTGCAAGAGCAAATGGAGGGAGG - Intergenic
931982399 2:67707952-67707974 CAGCAACAGCAGAGGGAAAGGGG - Intergenic
932246714 2:70202607-70202629 CTGCAACCGCTGATGGAGGGAGG - Intronic
932842733 2:75098954-75098976 CAGAACCAGCAGGTGGAGTGAGG + Intronic
933165056 2:79066461-79066483 CTGAAAGGGCATCTGGAGAGAGG - Intergenic
933331168 2:80895084-80895106 CACAAACAGGAGATGGAGTGGGG - Intergenic
933638639 2:84735045-84735067 CTGAAAGAGCAGATGGAGGGAGG - Intronic
933946394 2:87289589-87289611 GTGGAACAGCAGGTGGAGGGTGG - Intergenic
934121213 2:88841663-88841685 CTGAAATCGCAGTTGGAAAGTGG + Intergenic
935043335 2:99455887-99455909 GTGAAAAAGCAGGTGGAGGGGGG - Intronic
935390085 2:102541834-102541856 CTGAATCAGCAGATGTGGGGTGG + Intergenic
935473229 2:103484941-103484963 CTGAAACAGAAAATGGAGCCTGG + Intergenic
935854573 2:107260108-107260130 CGCAATCAGCAGATGGACAGGGG - Intergenic
936333801 2:111571952-111571974 GTGGAACAGCAGGTGGAGGGTGG + Intergenic
936398655 2:112149473-112149495 CTGAGCCAGCATATGGAGGGAGG - Intronic
937016525 2:118611075-118611097 ATGGAACAGCAGATGGGAAGGGG - Intergenic
937588839 2:123590061-123590083 GAGACACAGCAGAAGGAGAGTGG + Intergenic
937988477 2:127649379-127649401 CTGAAGCAGAGGCTGGAGAGAGG - Intronic
938041215 2:128077811-128077833 CTGAAACAAGAGATGAAGATTGG - Intergenic
939249638 2:139667336-139667358 CTGATTCAGCAGAGGGAGAGAGG - Intergenic
939304513 2:140393580-140393602 CTGAAATAGAAGATGGAAAATGG - Intronic
939406612 2:141766603-141766625 CTCCAACAGAAAATGGAGAGAGG + Intronic
940147772 2:150565300-150565322 GTGAAACAGCAGAAGGATAAAGG + Intergenic
940695645 2:156974109-156974131 CTGTTACAGTAGATTGAGAGTGG - Intergenic
942053453 2:172162263-172162285 CTCAAGCAGAAGATGGAGACAGG - Intergenic
942262337 2:174181341-174181363 ATGAAACAGTAGCTGGGGAGAGG + Intronic
942623447 2:177873672-177873694 CAGGGACAGGAGATGGAGAGAGG - Intronic
942954280 2:181756194-181756216 GTAAAACATGAGATGGAGAGAGG + Intergenic
944172274 2:196793130-196793152 GAGAAACATCAGATGGAGTGAGG - Exonic
944258935 2:197655122-197655144 CTGAAACAACAGAATGAAAGGGG - Intronic
945036630 2:205709092-205709114 CTAAGACAGCAGATGGAGGACGG + Intronic
945982788 2:216327562-216327584 CTGAAACAGGTGACTGAGAGAGG - Intronic
946697083 2:222370575-222370597 CTGAAACATAAGACTGAGAGAGG + Intergenic
947268374 2:228306495-228306517 CTGAATCGGGGGATGGAGAGGGG + Intergenic
947486951 2:230559262-230559284 GAGAAACAGCAGATGCAGAAAGG + Intergenic
1168783282 20:513659-513681 TTGAAACAGCAGAAGAAGACTGG - Intronic
1169338047 20:4773639-4773661 CTGATTCAGCAGATGGAGTAGGG - Intergenic
1169666223 20:8039339-8039361 ATGAAACTGTAGATGCAGAGAGG - Intergenic
1170470472 20:16663528-16663550 GAGAAACAGCAGATGCAGAAAGG - Intergenic
1170503993 20:17005019-17005041 TTTAAATAGCAGATGGAGAAAGG - Intergenic
1170724392 20:18913377-18913399 GGGAAACAGAAGATTGAGAGTGG + Intergenic
1172054750 20:32146434-32146456 CTGAAGCAGCAGATAGCCAGAGG + Intronic
1172526755 20:35604427-35604449 CTGAATCGGCAGATCCAGAGTGG + Intergenic
1173631962 20:44523108-44523130 GGGGAACAGCACATGGAGAGAGG - Intergenic
1174697845 20:52578496-52578518 ATGAAGCAGCAGCTGGTGAGGGG + Intergenic
1174722578 20:52829190-52829212 ATGAAACAACAAATGGAGAGTGG - Intergenic
1176044514 20:63085418-63085440 CAGGAACAGCAGAGGGAGGGAGG + Intergenic
1177682385 21:24389333-24389355 CTGAAATGGAAGATGGAGAAAGG - Intergenic
1178427840 21:32492931-32492953 CTGAGACAGCAGACACAGAGAGG - Intronic
1178738410 21:35173738-35173760 CCAAAACAGCAGATGGAAAAGGG - Intronic
1178974693 21:37210837-37210859 CTGAAAAAAGAGATGGGGAGGGG - Intergenic
1179311082 21:40196666-40196688 ATGAAACAGAAGAAAGAGAGGGG - Intronic
1179665185 21:42906424-42906446 ATCAAAGAGCAGACGGAGAGGGG - Intronic
1180032836 21:45224030-45224052 CTGCACCTGCAGAAGGAGAGGGG + Exonic
1180573112 22:16748325-16748347 CAGAAACAGCAGACGGAGTCCGG - Intergenic
1181577425 22:23803770-23803792 CTCACACAGCAGAAGCAGAGTGG - Intronic
1181828477 22:25539349-25539371 CTGGAACAGAAGAAGGAGATTGG - Intergenic
1182420670 22:30247147-30247169 CTGGACTAGCAGATGGAGACTGG + Intergenic
1183207696 22:36431114-36431136 CTAAAACACCAGGTGGACAGGGG + Intergenic
1183329999 22:37214255-37214277 CAGAAACAGCAGGTGCAGAAAGG + Intergenic
1183330640 22:37219036-37219058 CAGCAAGAGCAGATGGAGGGTGG - Intergenic
1183566052 22:38616119-38616141 CTGGCAGAGAAGATGGAGAGGGG + Intronic
1183730228 22:39614439-39614461 CTGAAGCAAGAGCTGGAGAGAGG - Intronic
1184095624 22:42314785-42314807 CTGGAGCAGCATCTGGAGAGGGG + Intronic
1184722204 22:46321431-46321453 CTGAAAACGGAGGTGGAGAGAGG + Intronic
949264773 3:2143960-2143982 CTGTAACAGCAAATAGTGAGAGG + Intronic
949729933 3:7097152-7097174 CAGGTAAAGCAGATGGAGAGTGG + Intronic
949963191 3:9331778-9331800 ATGAAATACCACATGGAGAGAGG + Intronic
950212018 3:11130703-11130725 CTGAGACAGCAGATGTGCAGGGG - Intergenic
950410814 3:12835513-12835535 CTGAAGCAGCAGCTGGTGGGAGG + Exonic
952329517 3:32351128-32351150 CTGACACAGCAGATGAACATGGG + Intronic
952577173 3:34789477-34789499 CTGGAACAGCAGAGGGACAGTGG - Intergenic
953771761 3:45782909-45782931 CTGAAATAGAAGATGGAATGTGG - Intronic
954951476 3:54478255-54478277 CTGAAACTGCAGATACAAAGAGG - Intronic
954995451 3:54877155-54877177 CTAAAATAGGAGATAGAGAGGGG + Intronic
955143871 3:56296592-56296614 ATGGGACAGCACATGGAGAGGGG + Intronic
956699890 3:71949509-71949531 CTGAAATATTAGATGGATAGTGG + Intergenic
958987556 3:100799970-100799992 CTGAAACAGGGAATAGAGAGAGG - Intronic
959838432 3:110947885-110947907 CTGGAACAGGAGCTAGAGAGTGG - Intergenic
960140489 3:114147558-114147580 CTGAAAAAGCAAGGGGAGAGGGG + Intronic
960208239 3:114929264-114929286 CTGAAAAAACAGAAGCAGAGAGG + Intronic
960447292 3:117763881-117763903 CTGGTACAGCAGCTGGTGAGGGG + Intergenic
960620988 3:119636527-119636549 CAGAAACAGAAGATGGTGACTGG + Intronic
960963652 3:123089891-123089913 AGGACATAGCAGATGGAGAGAGG + Intronic
961356051 3:126340719-126340741 CTGAAAAAGCAGGTGGAGATGGG - Intergenic
961456669 3:127027979-127028001 ATCAAGCAGCAGATGGAGAAGGG + Exonic
961589859 3:127970726-127970748 CAGAAAAGGCAGATGGATAGAGG + Intronic
961822735 3:129583526-129583548 ATGAAACAGCAGAGGCGGAGGGG + Intronic
962057115 3:131884350-131884372 CTCAAGTAGTAGATGGAGAGTGG + Intronic
962185537 3:133255278-133255300 CTGAAACAAAAGATGGAAATAGG + Intronic
962413972 3:135166119-135166141 GGGAAACGGCACATGGAGAGGGG - Intronic
962538247 3:136350717-136350739 AAGAAACTGCAGCTGGAGAGAGG + Intronic
963286899 3:143442100-143442122 CTGAAATAGGAGAGGGAGACAGG + Intronic
963748454 3:149149513-149149535 AAGCACCAGCAGATGGAGAGAGG + Intronic
964108364 3:153063165-153063187 AAGAAGCAGCAGAGGGAGAGGGG - Intergenic
964739936 3:159954525-159954547 CTGAATCAGCAGATTGAGTGAGG - Intergenic
967324886 3:188229168-188229190 CTGAGACAGGAGGTGGAGGGTGG + Intronic
967417533 3:189235389-189235411 GTGAAAGGGAAGATGGAGAGAGG + Intronic
968981771 4:3854010-3854032 GTGACACAGCAGACGGACAGAGG + Intergenic
969134562 4:5019743-5019765 CAGGAACAGCAGATGGAGAGGGG + Intergenic
970466239 4:16325855-16325877 CAGAAAAAGCAGAAGCAGAGAGG + Intergenic
970907181 4:21229634-21229656 ATAATACAGAAGATGGAGAGAGG + Intronic
971771366 4:30901285-30901307 CAGAAAAACCAGATAGAGAGAGG + Intronic
971811053 4:31427763-31427785 CTGACACCTCAGAAGGAGAGAGG + Intergenic
973090077 4:46124844-46124866 ATGCAAAAGCAGATGGGGAGTGG - Intergenic
973849356 4:54945924-54945946 CTGAAGCAGGAGAGGGCGAGAGG - Intergenic
976221053 4:82757125-82757147 CTGAAAGCGAGGATGGAGAGAGG - Intronic
978752323 4:112264085-112264107 CTAAAACAGCAGAGAGAGAGAGG - Intronic
979185055 4:117778254-117778276 CTGAAACAGAAGATTTAGAAAGG - Intergenic
980343617 4:131583810-131583832 CTGCAATTGCTGATGGAGAGAGG + Intergenic
981021729 4:140036299-140036321 TGGACACAGCAGCTGGAGAGAGG + Intronic
981089412 4:140717212-140717234 CTGAACCAGGAGATGCAGACAGG + Intronic
981152731 4:141397924-141397946 CTCCAACAGCAGAGGGAGAAGGG - Intergenic
984017909 4:174447593-174447615 GAGAAACAGCAGATGCAGAAAGG - Intergenic
986087751 5:4468612-4468634 CTGACTCAGCAGGAGGAGAGAGG - Intergenic
986572463 5:9179805-9179827 CTGTAAGAGCAGATGCAGTGTGG + Intronic
986639750 5:9860646-9860668 CTGATACTGCGGAAGGAGAGAGG + Intergenic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
988335812 5:29908077-29908099 CTGAAGGAGCAGAGGGGGAGGGG - Intergenic
988400131 5:30751596-30751618 ATGAAACAGGGGATGGAGTGGGG - Intergenic
988824820 5:34925460-34925482 ATGAAACAGAGGATGGACAGTGG + Exonic
990354348 5:54951148-54951170 ATGAGACAGCAGAGGAAGAGAGG - Intergenic
990504730 5:56433098-56433120 GTGAGACAGCAGAGGGAGAGAGG + Intergenic
991247598 5:64524771-64524793 CTGAAGCAGGAGAGGGAGAGAGG - Intronic
992676329 5:79109802-79109824 CTGCAACAGCAGCTGGGGAAAGG + Intronic
993001912 5:82389028-82389050 CTGAAGGAGCACATGGAGGGCGG - Intergenic
993050685 5:82922653-82922675 TGGAAATGGCAGATGGAGAGGGG - Intergenic
993132038 5:83911101-83911123 AAGAAACAGGAGATGGAGTGAGG - Intergenic
998056121 5:139079152-139079174 GTGAAACATCAGATGAAAAGGGG + Intronic
999257012 5:150215349-150215371 GTGAAGCAGCAGATTCAGAGGGG - Intronic
999641713 5:153679443-153679465 ATGAAACAGCAAATCCAGAGTGG + Intronic
1000186234 5:158860884-158860906 GTGAAACAGCTGATGGTTAGAGG - Intronic
1000411417 5:160937729-160937751 CTGCAACTGCTGATGGAGGGAGG + Intergenic
1001751241 5:174133240-174133262 CTGAACCAGGAGGAGGAGAGGGG - Intronic
1002765858 6:238088-238110 CTGAAACAACACATGGGGCGTGG - Intergenic
1003227225 6:4217363-4217385 CTCAACCAGCAGGTGAAGAGGGG + Intergenic
1007004556 6:38348210-38348232 CAGAAAAAGCAGAAAGAGAGAGG - Intronic
1007301225 6:40869386-40869408 GTGCAACAGAAGATGGACAGAGG + Intergenic
1007397641 6:41586713-41586735 CTGAAGCAGCGGAAGGAGGGAGG + Intronic
1009814391 6:68712156-68712178 ATGAAACAGGAGTTGGACAGAGG + Intronic
1010011941 6:71057919-71057941 ATAAAACAGCAGATGCAGGGAGG - Intergenic
1010807328 6:80253326-80253348 AGGAAACAGCAGATCTAGAGAGG + Intronic
1011217301 6:85018599-85018621 CTGAGACCGCAGAGGCAGAGTGG - Intergenic
1011327056 6:86160224-86160246 CTGATACAGGAGATTTAGAGTGG - Intergenic
1011587617 6:88943734-88943756 CTGAAAGAGCTGATGGAAATAGG - Intronic
1013168175 6:107612541-107612563 CTGAACCAGAAACTGGAGAGTGG + Intronic
1013543513 6:111134181-111134203 CAGAATCAGAAGATGGAGATTGG + Intronic
1013875071 6:114815566-114815588 CTGATATATCACATGGAGAGAGG - Intergenic
1014049112 6:116931036-116931058 GTGAAAGTGCAGATGGAAAGAGG + Intronic
1014168700 6:118254028-118254050 CAGAGACAGCAGATGGGGAGAGG + Intronic
1014666409 6:124243166-124243188 CTGAAACAGGAGGTAAAGAGGGG + Intronic
1015022177 6:128489859-128489881 CTGAAAATGCAGATGCAGAATGG - Intronic
1015027444 6:128553093-128553115 CAAAAACAGCAGCTGGAGAAAGG - Intergenic
1015675315 6:135739694-135739716 GTGAAAGCGCAGATGGGGAGGGG + Intergenic
1016754963 6:147674827-147674849 GGGAAACAGCAGAAGGAGAGTGG - Intronic
1017336134 6:153262486-153262508 CTGTAAGTGCACATGGAGAGTGG - Intergenic
1017590972 6:155977633-155977655 CTGAAACAGTAGAGGAAGAAAGG + Intergenic
1017882915 6:158573891-158573913 CTGATGCAGCTGATGGGGAGGGG + Intronic
1018278994 6:162164305-162164327 CTGAGGCAGGAGATGGAGATGGG - Intronic
1019649933 7:2151419-2151441 CTGAAACAGCAGGAGGCCAGTGG + Intronic
1019813549 7:3182810-3182832 CTGGAACAGGAGGTGGGGAGAGG - Intergenic
1020015730 7:4830435-4830457 CGCAAACAGCCGTTGGAGAGTGG + Intronic
1020211500 7:6161366-6161388 CTGCATCAGGAGATGGAGTGGGG + Exonic
1020959045 7:14779241-14779263 TTGTAAAAGCAGGTGGAGAGGGG + Intronic
1022405657 7:30087572-30087594 CTGACACAGCAGGTATAGAGAGG - Intronic
1023645994 7:42315645-42315667 TTCAAACAGCAGAGGGAAAGGGG - Intergenic
1025285255 7:57655356-57655378 CAGAAACAGCAGACGGAGTCCGG - Intergenic
1025851314 7:65246956-65246978 CTGTAAAAGTAGATGAAGAGGGG + Intergenic
1026134762 7:67650157-67650179 GTGAAACAGGACATGGAGGGTGG + Intergenic
1028750565 7:94377826-94377848 TTGAAACACCAGATGGACAGTGG - Intergenic
1029093535 7:98067298-98067320 TTGAAACTGCAGACGGGGAGGGG + Intergenic
1029690713 7:102179527-102179549 CTGAAGCAGCACCTGGACAGGGG - Intronic
1030056992 7:105591826-105591848 TTGAAACAAAAAATGGAGAGAGG - Intronic
1030393651 7:108958347-108958369 CTTAAGCAGCACATGGTGAGAGG + Intergenic
1031150101 7:118044366-118044388 CAGAAAGAGCAAATGAAGAGTGG + Intergenic
1031159933 7:118154306-118154328 CTGATACATCAGTTGGATAGGGG + Intergenic
1031505631 7:122578551-122578573 CTGACTCAGCAGATCTAGAGTGG + Intronic
1032468921 7:132164227-132164249 ATCAAGCAGCAGATGGAGAAGGG - Exonic
1032488453 7:132305975-132305997 CTGGAACTGTAGATGGAGAGGGG + Intronic
1034746580 7:153528756-153528778 CTGTAACAGTTCATGGAGAGTGG - Intergenic
1038592282 8:28850651-28850673 ATGAAAAAACAGATGCAGAGAGG + Intronic
1038848530 8:31252026-31252048 GAGAGAAAGCAGATGGAGAGCGG - Intergenic
1038857290 8:31347732-31347754 CTGGAGCAGAAGATAGAGAGAGG - Intergenic
1041862960 8:62535194-62535216 CTGAAACAGCACGTGGACTGTGG - Intronic
1042984896 8:74572647-74572669 ATGACACAGCAAATGGACAGAGG - Intergenic
1043526655 8:81104929-81104951 GTGAGACTGGAGATGGAGAGCGG - Intronic
1043809954 8:84727020-84727042 ATGAAACAGCAGATGAAGCTTGG + Intronic
1045055484 8:98364561-98364583 TTGGAAGAGCAGAGGGAGAGAGG - Intergenic
1045816545 8:106283345-106283367 CTGGAACCCTAGATGGAGAGAGG + Intronic
1046147050 8:110174005-110174027 CAGAAGCAGGAGGTGGAGAGGGG + Intergenic
1046274934 8:111946325-111946347 CAGAAACAGCAACTGGAGAAGGG + Intergenic
1047411851 8:124630402-124630424 CTGAAAGAGGAGGTGGAGAAAGG + Intronic
1048395915 8:134013881-134013903 CTGAAACAAGGGTTGGAGAGTGG - Intergenic
1048726371 8:137389815-137389837 CAAACACAGCATATGGAGAGAGG - Intergenic
1049312468 8:141940483-141940505 CTGTCAGAGCAGCTGGAGAGGGG - Intergenic
1050482144 9:6098289-6098311 ATGAAACAGAAGATGGAGTGTGG + Intergenic
1050670825 9:7995562-7995584 CTGAGGCAGGAGATGGAGATGGG - Intergenic
1051468818 9:17411573-17411595 CTTACACAGCAGAAGGTGAGAGG + Intronic
1052883175 9:33618179-33618201 CTGAAACAGAAGCCAGAGAGAGG - Intergenic
1053463826 9:38290541-38290563 CTGAAACAGCAGAGAGGCAGAGG - Intergenic
1053730914 9:41056107-41056129 CTGGAACAGAAGAAGGAGGGCGG - Intergenic
1054697599 9:68375983-68376005 CTGGAACAGAAGAAGGAGGGCGG + Intronic
1054917939 9:70512951-70512973 CTGAGACAGCTGGTGAAGAGAGG + Intergenic
1055515601 9:77030231-77030253 CTGACTCAGCAGATGTGGAGTGG + Intergenic
1055928835 9:81539013-81539035 CTGAATCAGCAGAAGGTGGGAGG + Intergenic
1056362328 9:85871312-85871334 ATAAAACACCACATGGAGAGAGG + Intergenic
1057327928 9:94083191-94083213 CAGAAACAGCAGTTGCACAGAGG - Intronic
1057396991 9:94689340-94689362 CTGGAACAGCAGGTGCTGAGGGG - Intergenic
1058421058 9:104833870-104833892 CTCAATCAGCAGATCCAGAGGGG + Intronic
1058713097 9:107698165-107698187 CTGAAAAAAGAAATGGAGAGAGG + Intergenic
1060127936 9:121067787-121067809 TTGAAGCAGCAGGAGGAGAGGGG - Intergenic
1062554378 9:137107358-137107380 ATGAACCGGCAGATGGAGACGGG + Exonic
1187485757 X:19701576-19701598 CTGAAGATGCAGATGGTGAGTGG - Intronic
1187507752 X:19890272-19890294 CTAAACCAGCAGATGGGGTGCGG + Intergenic
1188280196 X:28258226-28258248 CTGCTACCCCAGATGGAGAGAGG + Intergenic
1188500280 X:30818237-30818259 CTGGAACAGGAGTTAGAGAGAGG - Intergenic
1188546013 X:31308124-31308146 CTGGAACAGCAGGAGGTGAGTGG - Intronic
1188775585 X:34214658-34214680 CTGAAACAAACAATGGAGAGAGG + Intergenic
1189405024 X:40713839-40713861 CTGATTCAGCTGATGGAGTGTGG + Exonic
1189515278 X:41707298-41707320 ATGAAAGATCACATGGAGAGAGG + Intronic
1189528741 X:41856322-41856344 CCAAGAAAGCAGATGGAGAGTGG + Intronic
1190366126 X:49696122-49696144 ATGAAACAGCAGAGGGAGGTCGG - Intergenic
1190405502 X:50082888-50082910 CTGAAACAAAAGGTAGAGAGAGG - Intronic
1190713227 X:53084015-53084037 ATGAAACAGCACATGGTAAGAGG + Intronic
1191801165 X:65081318-65081340 CTGAATCAAAAGATGTAGAGAGG + Intergenic
1193481810 X:82036226-82036248 ATGAGACAGCAGGTGGAAAGGGG + Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1200236185 X:154468862-154468884 ATCAAGCAGCAGATGGAGAAGGG + Exonic