ID: 924817108

View in Genome Browser
Species Human (GRCh38)
Location 1:247452114-247452136
Sequence CCAGCGTCTCCACAGAGGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924817108_924817115 0 Left 924817108 1:247452114-247452136 CCTTACCTCTGTGGAGACGCTGG 0: 1
1: 0
2: 0
3: 4
4: 120
Right 924817115 1:247452137-247452159 GATGCGGAAGGGTCAGAACCAGG 0: 1
1: 0
2: 0
3: 9
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924817108 Original CRISPR CCAGCGTCTCCACAGAGGTA AGG (reversed) Intergenic
901875588 1:12165461-12165483 CCAGCGGCTCTGCAGAGTTAAGG + Intergenic
903130733 1:21278005-21278027 CCAGCAACTTCACAGAGGGAAGG + Intronic
903214314 1:21834898-21834920 CCACGGTCTGCACAGAGGTCCGG + Exonic
903743714 1:25573125-25573147 CCAGTTTCTCCCCAGGGGTAAGG + Intergenic
905632054 1:39524452-39524474 CCAGCCTCTCCACACAAGGAGGG + Intronic
908293490 1:62690684-62690706 CCAGCTCTTCCCCAGAGGTAGGG - Intergenic
910038597 1:82819515-82819537 CTTTCCTCTCCACAGAGGTATGG + Intergenic
914916896 1:151824512-151824534 ACAGCTTCTACACAGAGGAAAGG - Intronic
915510604 1:156384982-156385004 GCAGCGTCTCCACAGGGAGAGGG + Exonic
916758522 1:167796186-167796208 ACATCCTCTTCACAGAGGTAGGG - Intergenic
918866574 1:189907677-189907699 CCATCCTCCCCACAGAAGTATGG - Intergenic
918912551 1:190592316-190592338 GCCAAGTCTCCACAGAGGTAAGG - Intergenic
919327841 1:196131750-196131772 TCAGCTTCTACATAGAGGTAAGG - Intergenic
924817108 1:247452114-247452136 CCAGCGTCTCCACAGAGGTAAGG - Intergenic
924854680 1:247864585-247864607 CCAGTGAGTCCACAGAGTTACGG + Intronic
1063280172 10:4620119-4620141 CCAGCTTCTCCACAGAGCCCTGG + Intergenic
1068489803 10:57708937-57708959 TGAGCCTTTCCACAGAGGTAAGG + Intergenic
1069735341 10:70650271-70650293 CAAGTGTCTCCACAAAGTTAAGG - Intergenic
1070019922 10:72574740-72574762 CCAGCGTATCCAGTGAGGAAAGG + Intronic
1073256094 10:102152252-102152274 CCACCTTCACCTCAGAGGTAGGG - Exonic
1087061984 11:93987787-93987809 CCAGAGTCTCAACATAGGAAGGG - Intergenic
1089069726 11:115690030-115690052 CCAGGGGCTCCGGAGAGGTATGG - Intergenic
1089115668 11:116093262-116093284 CCAGCGTCAGCAGAGAGGTTTGG - Intergenic
1090653423 11:128825256-128825278 CCAGTGGCTCCAGAGAGGTGAGG - Intergenic
1099161309 12:79245064-79245086 CTTGCTTCTACACAGAGGTATGG - Intronic
1104054184 12:125216794-125216816 CCAGAGACTCCACAGATGTCTGG + Intronic
1109461307 13:62662327-62662349 CCAGAGTCTTAACTGAGGTATGG + Intergenic
1112372833 13:98809951-98809973 TGGGGGTCTCCACAGAGGTAGGG + Intronic
1113951896 13:114076649-114076671 CGAGCTTCTCCAGAGAGGGAAGG + Intronic
1118653691 14:67924877-67924899 CCAGCGTCTCATCAGAGACAAGG + Intronic
1120068732 14:80078145-80078167 CGAGCAAATCCACAGAGGTAAGG - Intergenic
1120237463 14:81909081-81909103 CCAGCTTCTGCAGAGAGGAAGGG + Intergenic
1122047785 14:99035923-99035945 CCAGCGCCTGCACGGAGGGAGGG - Intergenic
1130550354 15:84886599-84886621 CCAGCGCCTCCCCAGAGGCCAGG - Intronic
1132082888 15:98882624-98882646 CCAGTGTCACCTCAGAGGGATGG + Intronic
1132111135 15:99103070-99103092 GCAGGGTCTCCACATAGGTTTGG + Intronic
1137708667 16:50551588-50551610 CCAGTGTGTCTGCAGAGGTAGGG + Intronic
1141210321 16:81973597-81973619 CCATCGTCTCTACACAGGAAGGG - Intergenic
1142486272 17:249459-249481 GCAGCCTCTCCACAGAGGAGAGG + Intronic
1142983040 17:3682281-3682303 CCAGTGTCTGCACCGAAGTACGG + Intronic
1147332087 17:39705283-39705305 CCAGGGTCTCCACAGGGCTGGGG - Intronic
1147440239 17:40443379-40443401 CCAGCGCCTTCCCAGAGGTGGGG - Intergenic
1148618184 17:49015338-49015360 CCAGCATCTCCAGAGAGGCGGGG + Intronic
1150810371 17:68351655-68351677 CCAGCGTGTCCACAGGGTGATGG + Exonic
1151461233 17:74255404-74255426 CCACCTTCTCCACAGAGCTGTGG + Intronic
1152210404 17:79000212-79000234 CCACCGTGTCCACAGTGGTCTGG + Intronic
1153949542 18:10046518-10046540 CCAGCTCCTCCAGAGAGGAAAGG - Intergenic
1154171065 18:12050611-12050633 CCAGCTTATCCACAGAAGAAGGG + Intergenic
1159106039 18:64002760-64002782 CCAGCCTCTCCCAGGAGGTAGGG + Intronic
1164553612 19:29232959-29232981 CCAGCGTCTCCGCAGAGCCTAGG - Intergenic
1165746526 19:38233219-38233241 CCAGCACATCCACAGAGGGATGG - Intergenic
925751269 2:7091929-7091951 CCAGGGTATCCACATGGGTAGGG - Intergenic
928482090 2:31693196-31693218 CCAGTGACTCCACAGATGAATGG - Intergenic
929584300 2:43104159-43104181 CCAGCAAGACCACAGAGGTAAGG + Intergenic
929627169 2:43421249-43421271 CCAGGGTTTCCACAGAATTATGG + Intronic
931017811 2:58006051-58006073 CCAGCATCCCCCTAGAGGTAAGG + Intronic
932494122 2:72138182-72138204 CCAGCTGCTCCACAGACATAGGG + Intronic
932837292 2:75049567-75049589 CCACCATCTCCACAGTGGTGGGG - Exonic
938912560 2:135898791-135898813 CCAGCTTCTACACAGAGCTGGGG - Intergenic
942495070 2:176531584-176531606 CCAAAGACTCCAAAGAGGTAAGG - Intergenic
944674039 2:202020265-202020287 CCAGCCTCACCCCAGAGGTAGGG - Intergenic
945494978 2:210499045-210499067 CCACAGTCTCCACACAGGAATGG + Intronic
1174714037 20:52737773-52737795 TCAGGGGCTCCAGAGAGGTATGG - Intergenic
1175149458 20:56921644-56921666 CCAGCATCTTAGCAGAGGTACGG - Intergenic
1175966181 20:62661282-62661304 CCAGGGTCACGACAGAGGTTAGG - Intronic
1177464553 21:21458390-21458412 CCAGCGGCTCTCCAGAGCTAGGG - Intronic
1179135627 21:38677879-38677901 CCAGTTTCTCCACGGAGATAAGG + Intergenic
1180707982 22:17821421-17821443 ACAGCCCCTCAACAGAGGTAAGG - Exonic
1180729117 22:17968260-17968282 CCAACGCTTCCACAGAGGCAGGG - Intronic
1181434534 22:22902656-22902678 CCAGGGCCTCCATAGAGGTTTGG - Intergenic
1183993983 22:41619801-41619823 CCAGTGTCTCCACAGAAGCCAGG + Intronic
1184596802 22:45518866-45518888 CCAGCCTCTCCCGAGAGGTCTGG - Intronic
1184930926 22:47680818-47680840 CCTGCCCCTCCTCAGAGGTATGG - Intergenic
1185219169 22:49620618-49620640 CAGGCGTGTCCACAGAGGAAGGG - Exonic
952943367 3:38459673-38459695 GCAGCCTCTCCCCAAAGGTATGG + Intronic
959604042 3:108222524-108222546 CCACCATTTCCACAGAGGCAGGG - Exonic
960088947 3:113619371-113619393 CCAGCCTCTCCACTGAGAAATGG + Intronic
963028461 3:140942419-140942441 CCCGCGTCTCCTCAGACGCATGG - Intronic
964443113 3:156732395-156732417 CCAGTGTCTCCAAAGAGCTCAGG - Intergenic
968131855 3:196196732-196196754 CCAGAGGCTCCAGAGAGGCAGGG + Intergenic
968944221 4:3655104-3655126 CCAGCATCTCCACAGAAGAACGG - Intergenic
971958437 4:33453874-33453896 CCATGGTCTCCACACAGGAAGGG - Intergenic
972254212 4:37335772-37335794 ACAACTTTTCCACAGAGGTAGGG - Intronic
980072357 4:128257454-128257476 TCAGCTTCTTCACTGAGGTATGG - Intergenic
981825596 4:148937202-148937224 GCTTCTTCTCCACAGAGGTATGG - Intergenic
996692914 5:126360165-126360187 TCAGCGTCTGCTCAGAGGGATGG - Exonic
998321339 5:141235396-141235418 CCCACGTCTCCAGAGATGTACGG + Intergenic
999263176 5:150250156-150250178 CCTGGGTCTCCACAGAGGCCAGG - Intronic
1000117655 5:158168621-158168643 CCAGAGTCTCCACAATGGAAAGG - Intergenic
1000148721 5:158479101-158479123 CCAGCATCTCCAGAGAGGATTGG - Intergenic
1001980370 5:176033986-176034008 CCAGAGGCTGCCCAGAGGTAGGG + Intronic
1002237091 5:177810079-177810101 CCAGAGGCTGCCCAGAGGTAGGG - Intergenic
1002643919 5:180643782-180643804 CCGGCCGCTCCACAGAGCTATGG - Intronic
1004598480 6:17124532-17124554 CCAGTATCTCCCTAGAGGTAAGG + Intronic
1006110443 6:31741270-31741292 CAAGCTTCTCCAGAGAGGTGGGG + Exonic
1007715724 6:43854999-43855021 CCAGAGTTTCCAGAGAGGTAGGG + Intergenic
1009006686 6:57797474-57797496 ACTGGGACTCCACAGAGGTACGG - Intergenic
1009008852 6:57819883-57819905 ACTGGGACTCCACAGAGGTACGG - Intergenic
1019427395 7:984059-984081 CCAGAGTCTGCACAGAGTGAGGG - Intronic
1020067430 7:5199618-5199640 CCAGCTTATCCACAGAAGAAAGG - Exonic
1028879522 7:95864540-95864562 CCAACATCTCCCCAGAGCTAGGG - Intronic
1034386777 7:150747106-150747128 CCAGCTGCTCCAGAGAGGCAGGG - Intronic
1035274208 7:157737691-157737713 GCAGCCCCTCCACAGAGGAAGGG + Intronic
1035374258 7:158397011-158397033 CCTGGGTCTCCACAGAGGACAGG - Intronic
1036398384 8:8386999-8387021 CCACCCTCTTCCCAGAGGTAGGG - Intergenic
1037203024 8:16281428-16281450 TCAGCTTCTTCACAGAGGAAGGG - Intronic
1044115143 8:88326936-88326958 CCAGGGTCTCCACAGCTGGAAGG + Intronic
1047772365 8:128039554-128039576 CCACCATCTCCCCTGAGGTATGG - Intergenic
1048033221 8:130652520-130652542 CCAGGGTGTCCTCAGAGGCAGGG + Intergenic
1048328969 8:133459497-133459519 CCAGCGTCTCCCCAGCTCTAGGG + Exonic
1048742783 8:137580567-137580589 CCAGGGTGGCCACAGAGGGAAGG - Intergenic
1049441023 8:142609892-142609914 CCAGTGTCCCCACAAAGGCAGGG + Intergenic
1049441067 8:142610048-142610070 CCAGTGTCCCCACAAAGGCAGGG + Intergenic
1049441082 8:142610100-142610122 CCAGTGTCCCCACAAAGGCAGGG + Intergenic
1049441097 8:142610152-142610174 CCAGTGTCCCCACAAAGGCAGGG + Intergenic
1049720374 8:144112819-144112841 CCAGCGCCTCCACGGGGGAAAGG - Intronic
1053123093 9:35560624-35560646 CCAGGGCCTCCTCAGAGGCAGGG - Exonic
1054716353 9:68560779-68560801 CCAGCCTCTCCAAAGTGGAAGGG - Intergenic
1055666363 9:78556939-78556961 CCAGCGTTTGCAGACAGGTACGG + Intergenic
1056239986 9:84635404-84635426 TCAGGGTGTGCACAGAGGTAGGG + Intergenic
1056322109 9:85445053-85445075 CCAACATCACCACAGAGGGAAGG - Intergenic
1059747377 9:117216300-117216322 TCAGCACCTCCACAGAGGTAGGG + Intronic
1061262318 9:129487149-129487171 CCAGCCTTGCCACAGAGGTCTGG - Intergenic
1061979164 9:134090248-134090270 CCAGGGTGTCCACAGAGGCCAGG + Intergenic
1062122119 9:134839439-134839461 CCAGTCTCTCCCCAGAGGGACGG - Intronic