ID: 924818160 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:247460959-247460981 |
| Sequence | TAGAACATTGAGAAGGAGCC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 924818157_924818160 | 20 | Left | 924818157 | 1:247460916-247460938 | CCATCAAAAAAAAAAAAAAAAAA | 0: 1667 1: 8008 2: 116622 3: 91487 4: 137548 |
||
| Right | 924818160 | 1:247460959-247460981 | TAGAACATTGAGAAGGAGCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 924818160 | Original CRISPR | TAGAACATTGAGAAGGAGCC AGG | Intergenic | ||
| No off target data available for this crispr | |||||