ID: 924818160

View in Genome Browser
Species Human (GRCh38)
Location 1:247460959-247460981
Sequence TAGAACATTGAGAAGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924818157_924818160 20 Left 924818157 1:247460916-247460938 CCATCAAAAAAAAAAAAAAAAAA 0: 1667
1: 8008
2: 116622
3: 91487
4: 137548
Right 924818160 1:247460959-247460981 TAGAACATTGAGAAGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924818160 Original CRISPR TAGAACATTGAGAAGGAGCC AGG Intergenic
No off target data available for this crispr