ID: 924823438

View in Genome Browser
Species Human (GRCh38)
Location 1:247516152-247516174
Sequence AACACTCATGTCAATACGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 51}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924823433_924823438 14 Left 924823433 1:247516115-247516137 CCCACAAGAACAGGGGTGTTTTG 0: 1
1: 0
2: 0
3: 3
4: 132
Right 924823438 1:247516152-247516174 AACACTCATGTCAATACGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 51
924823434_924823438 13 Left 924823434 1:247516116-247516138 CCACAAGAACAGGGGTGTTTTGC 0: 1
1: 0
2: 0
3: 7
4: 101
Right 924823438 1:247516152-247516174 AACACTCATGTCAATACGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 51
924823431_924823438 21 Left 924823431 1:247516108-247516130 CCTAAAACCCACAAGAACAGGGG 0: 1
1: 0
2: 1
3: 9
4: 188
Right 924823438 1:247516152-247516174 AACACTCATGTCAATACGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 51
924823435_924823438 -9 Left 924823435 1:247516138-247516160 CCACCTACAGTAAGAACACTCAT 0: 1
1: 0
2: 0
3: 6
4: 111
Right 924823438 1:247516152-247516174 AACACTCATGTCAATACGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924823438 Original CRISPR AACACTCATGTCAATACGGC AGG Intronic
909956130 1:81781316-81781338 TACACCCTTGTCACTACGGCAGG - Intronic
911610712 1:99956659-99956681 AACATTCATTTCATTAGGGCAGG - Intergenic
917052952 1:170945006-170945028 AAGACTCATGTGATTAGGGCAGG - Intronic
918086635 1:181251090-181251112 CTCACTCATGTCAATGCTGCTGG + Intergenic
918712249 1:187746192-187746214 CACACTCATGTAAATAAGGGAGG - Intergenic
924083537 1:240424426-240424448 AAAACTGATGTCAATATGTCTGG - Intronic
924318681 1:242825180-242825202 CACACTCATGTCAATCCTGGAGG - Intergenic
924823438 1:247516152-247516174 AACACTCATGTCAATACGGCAGG + Intronic
1069162696 10:65110375-65110397 TTCACTCATGTCAATGCCGCTGG - Intergenic
1070490207 10:76968976-76968998 AAAACTAATGTCAAGATGGCAGG + Intronic
1070796943 10:79222404-79222426 AACACTCATGTCCACAGGGCTGG - Intronic
1072215489 10:93284110-93284132 AAGAATCATCTCAATGCGGCAGG + Intergenic
1082572672 11:54762230-54762252 CTCACTCATGTCAATGCTGCTGG + Intergenic
1087680661 11:101215428-101215450 CTCACTCATGTCAATGTGGCTGG - Intergenic
1094865587 12:34526975-34526997 CTCACTCATGTCAATGCTGCTGG + Intergenic
1100077729 12:90806926-90806948 AACTCTAATGGCAATACAGCTGG - Intergenic
1101501716 12:105310460-105310482 CTCACTCATGTCAATGCTGCTGG + Intronic
1102203990 12:111077687-111077709 AACACTCTTGTAAATAAAGCTGG - Intronic
1102688636 12:114743373-114743395 TACACTCATGTCCCTACCGCTGG - Intergenic
1115103071 14:29726527-29726549 GACACTTATGTCAATACAGGTGG + Intronic
1120183857 14:81372255-81372277 AAGAATCATATCATTACGGCCGG + Intronic
1121328781 14:93036722-93036744 CCCACTCATCTCAATACCGCAGG + Intronic
1127208413 15:56744900-56744922 AAGACTAATGTCAATAGGGCAGG - Intronic
1128158563 15:65408062-65408084 AAAATTCATATCAATATGGCTGG - Intronic
1136488274 16:30587110-30587132 AAAATTCATGTGAATTCGGCCGG + Intergenic
1155724823 18:29067868-29067890 AATACTCATGTCAAGATGGCAGG + Intergenic
1158221427 18:55154784-55154806 AACCCTCATGTGAATCCGTCTGG + Intergenic
1160672135 19:370643-370665 AAAACTGATGTGAATACGCCGGG - Intronic
1163927256 19:20357513-20357535 TACACTCATGGCAAAACTGCTGG - Intergenic
1164289124 19:23851336-23851358 CTCACTCATGTCAATGCTGCTGG - Intergenic
1164378119 19:27707409-27707431 CTCACTCATGTCAATGCCGCTGG - Intergenic
926704044 2:15824071-15824093 CCCACTCATGTCAAAATGGCAGG - Intergenic
935142510 2:100365826-100365848 CTCACTCATGTCAATGCTGCTGG - Intergenic
942613919 2:177770141-177770163 AATGCTGATGTCAATAGGGCAGG - Intronic
943827344 2:192413307-192413329 AATACTCATGTTAATATGGAAGG - Intergenic
1169325275 20:4670704-4670726 AACACTCATGAAAATACCGTGGG + Intergenic
1176229812 20:64026520-64026542 AACAAACATGTTCATACGGCCGG + Intronic
953155294 3:40365715-40365737 GACACTTATGTTAATACGTCAGG + Intergenic
961227466 3:125264833-125264855 AACAATCATTTCAATGAGGCAGG + Intronic
961923005 3:130447448-130447470 CTCACTCATGTCAATGCCGCTGG - Intronic
963775320 3:149433318-149433340 AACACTGTTGTCAATACCACGGG + Intergenic
974605514 4:64145347-64145369 CTCACTCATGTCAATGCTGCTGG - Intergenic
977114263 4:93002818-93002840 AACATTTATGTCAACAGGGCTGG + Intronic
979748383 4:124245025-124245047 TACATTCATGTCAATTTGGCAGG + Intergenic
980688749 4:136263685-136263707 AAGACACATGTCAATACCTCTGG + Intergenic
985069383 4:186152945-186152967 AACACTCATGTAAATGTGGCTGG + Intronic
989318509 5:40108799-40108821 CTCACTCATGTCAATGCTGCTGG + Intergenic
1017115321 6:150970645-150970667 AACACTCAGGAAAATAAGGCAGG - Intronic
1017850478 6:158300904-158300926 CTCACTCATGTCAATGCTGCTGG - Intronic
1018136989 6:160788576-160788598 AACTCTCATGGCAAAACTGCTGG + Intergenic
1020010834 7:4805159-4805181 CACACACATGTCCATACGGAGGG - Intronic
1052687782 9:31776474-31776496 GTCACTCATGTCAATGCTGCTGG + Intergenic
1054856256 9:69902552-69902574 ACCACTCAAGTCAATAAAGCGGG - Intronic
1058074805 9:100639811-100639833 AACACTCCTGAGAATAAGGCAGG - Intergenic
1189408004 X:40743314-40743336 AACACTCATGTAGGTATGGCAGG - Intergenic
1198448633 X:136743815-136743837 AGCACTCATCTAAATAAGGCAGG + Intronic