ID: 924825220

View in Genome Browser
Species Human (GRCh38)
Location 1:247531690-247531712
Sequence GAACTTGCCCTGCTCATGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 1, 3: 68, 4: 196}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924825220 Original CRISPR GAACTTGCCCTGCTCATGGG AGG Exonic
901440266 1:9273424-9273446 GACCTTGCCCTGCTTCTGCGTGG - Intergenic
901512549 1:9724683-9724705 GCCCTTGCCCTGATAATGGGTGG - Intronic
901652990 1:10753681-10753703 GAACTTGCCCTGCTCTAGCCTGG - Intronic
902864734 1:19270547-19270569 GAACTTGCCCTGCTCGGGTGAGG + Intergenic
902866952 1:19285984-19286006 GAACTTGCCCTGCTCAGGTGAGG + Exonic
904631243 1:31843921-31843943 AGACTTGCCATGCTCCTGGGTGG + Intergenic
906169160 1:43709176-43709198 GAACCTGAGATGCTCATGGGTGG + Intronic
907648812 1:56273194-56273216 GAACATTCCATGCTCATGGATGG + Intergenic
908457155 1:64314995-64315017 CATCTTCCCCTGGTCATGGGTGG + Intergenic
910383996 1:86661969-86661991 GAACATTCCATGCTCATGGATGG + Intergenic
913404416 1:118473713-118473735 GTACTTGCCTTCCTGATGGGAGG + Intergenic
913466995 1:119152898-119152920 GAACATTCCATGCTCATGGGTGG - Intergenic
913978629 1:143488100-143488122 GAGCTTCCCCTGGCCATGGGGGG + Intergenic
914218944 1:145659893-145659915 GAACATTCCATGCTCATGGTAGG - Intronic
914459970 1:147874638-147874660 GAACATTTCATGCTCATGGGTGG - Intergenic
914471527 1:147982768-147982790 GAACATTCCATGCTCATGGTAGG - Intronic
915324378 1:155073454-155073476 GAACCTGCCCAGCCCAGGGGAGG + Intergenic
915711757 1:157906353-157906375 GAACATTCCATGCTCATGGTTGG + Intergenic
915768065 1:158387122-158387144 GAACATTCCATGCTCATGGGTGG + Intergenic
916586221 1:166152621-166152643 GAACTTCCCCTGAGCATGTGGGG - Intronic
916905134 1:169275089-169275111 GAACATTCCATGCTCATGGGTGG - Intronic
917182899 1:172318756-172318778 GAACATTCCATGCTCATGGGTGG + Intronic
917984733 1:180304622-180304644 GAACATTCCATGCTCATGGTAGG + Intronic
918432457 1:184476257-184476279 AAACTTCCACTGTTCATGGGCGG + Intronic
919440526 1:197628044-197628066 GAACATTCCATGCTCATGGGTGG + Intronic
919457125 1:197833641-197833663 GAACATTCCATGCTCATGGGTGG + Intergenic
919717837 1:200798289-200798311 GAACATTCCATGCTCATGGGTGG - Intronic
920773077 1:208908497-208908519 GAGCTTGCCCTGCTCAGTGGTGG - Intergenic
920935155 1:210425964-210425986 GAACATTCCATGCTCATGGATGG - Intronic
922198148 1:223377653-223377675 GAGCTTCCCCTTCTCATAGGAGG + Intergenic
924007177 1:239625122-239625144 GAACATTCCATGCTCATGGGTGG - Intronic
924825220 1:247531690-247531712 GAACTTGCCCTGCTCATGGGAGG + Exonic
1062837234 10:643592-643614 GAGCTTGGCATGCTCCTGGGTGG - Intronic
1062916824 10:1246955-1246977 GAACATTCCATGCTCATGGGTGG - Intronic
1064563586 10:16617354-16617376 GAACATTCCATGCTCATGGATGG + Intronic
1065143904 10:22747417-22747439 GAACATTCCATGCTCATGGGTGG + Intergenic
1066820370 10:39479308-39479330 GAACATTCCATGCTCATGGGTGG - Intergenic
1067274614 10:44822719-44822741 GGACTTCCCATGCTCTTGGGAGG - Intergenic
1067965862 10:50911895-50911917 GAACATTCCATGCTCATGGGTGG - Intergenic
1068607627 10:59023784-59023806 GTACTTGCCCTGCTCTTTGGTGG - Intergenic
1071193127 10:83125764-83125786 AAACATGCCATGCTCATGGATGG + Intergenic
1072439125 10:95438447-95438469 GCAGTGGCCCTGCTCATGTGTGG - Intronic
1074627055 10:115201853-115201875 GAATATTCCATGCTCATGGGTGG - Intronic
1076669386 10:132111352-132111374 GACCTTGCTGTGCTCATGGGGGG - Intronic
1077742176 11:4858591-4858613 GAACATTCCATGCTCATGGATGG + Intronic
1078489488 11:11756083-11756105 GACTTTGCCCTGCCCATGGTGGG + Intergenic
1079014761 11:16859135-16859157 GAGCTGTCCCTGCTCATGGGGGG - Intronic
1079877673 11:25879769-25879791 GAACATTCCATGCTCATGGATGG + Intergenic
1080138262 11:28884044-28884066 GAACATTCCATGCTCATGGATGG + Intergenic
1080982873 11:37429520-37429542 GAACATTCCATGCTCATGGATGG - Intergenic
1081511402 11:43777228-43777250 GAACATTCCATGCTCATGGGTGG - Intronic
1081945932 11:46993899-46993921 GAACATTCCATGCTCATGGATGG - Intronic
1082240892 11:49869414-49869436 GAACATTCCATGATCATGGGTGG + Intergenic
1083532261 11:63434811-63434833 AAACTTTCCATGCTCATGGATGG + Intergenic
1084170840 11:67400343-67400365 GACTTGGCCCGGCTCATGGGTGG - Intronic
1087442484 11:98204379-98204401 AAACATGCCATGCTCATGGATGG + Intergenic
1088070607 11:105779308-105779330 GAACATTCCATGCTCATGGGTGG + Intronic
1088195019 11:107264515-107264537 AAACCTGCCCTGCTAATGGGGGG + Intergenic
1090469447 11:126967292-126967314 GAACTTGCAGTGCTCTTTGGAGG - Intronic
1094876048 12:34644027-34644049 GAACATTCCATGCTCATGGTAGG + Intergenic
1097911893 12:64979398-64979420 GAACATGCCATGCTCATGGATGG - Intergenic
1097917030 12:65032071-65032093 GAACATTCCATGCTCATGGATGG - Intergenic
1098326381 12:69307653-69307675 GAACATCCCATGCTCATGGGTGG + Intergenic
1099271987 12:80521984-80522006 GAACATCCCATGCTCATGGTAGG - Intronic
1101255694 12:102974429-102974451 GCAAATGCCCAGCTCATGGGTGG - Intergenic
1101902115 12:108798564-108798586 TGACTTGCCCTGCTCATCAGTGG + Intronic
1102556331 12:113729251-113729273 GAAAGTGCCGTGCACATGGGAGG + Intergenic
1104311307 12:127656320-127656342 CAACATGCCCTGCTCAGGAGTGG - Intergenic
1105220700 13:18323296-18323318 GAACTTCCCCTGGCCATGGGGGG - Intergenic
1108634481 13:52318844-52318866 GAACTTGCCTTGAACTTGGGAGG - Intergenic
1109185342 13:59261318-59261340 GAATTTCCCCAGCTCATGTGTGG + Intergenic
1111765404 13:92521145-92521167 GAACATTCCATGCTCACGGGTGG + Intronic
1112566043 13:100552054-100552076 AAGCTTGCCCTGCACATGGCTGG - Intronic
1112914980 13:104537091-104537113 GAACTTGCCCTGATGATAGCTGG + Intergenic
1113661233 13:112107641-112107663 GAACTAGCATTGCTCAGGGGAGG - Intergenic
1115884075 14:37951933-37951955 GAACATTCCATGCTCATGGTAGG - Intronic
1116026632 14:39523181-39523203 GAACATTCCATGCTCATGGGTGG - Intergenic
1116483164 14:45415914-45415936 GAACATTCCATGCTCATGGACGG + Intergenic
1116684298 14:48018130-48018152 GAACATTCCATGCTCATGGATGG - Intergenic
1117350295 14:54874860-54874882 GAACATTCCATGCTCATGGGTGG + Intronic
1118579048 14:67274744-67274766 GAACATTCCATGCTCATGGATGG - Intronic
1118583570 14:67329100-67329122 GAACATTCCATGCTCATGGATGG - Intronic
1119267346 14:73270881-73270903 GACCCTGCCCTACTCATGGTTGG + Intronic
1120066156 14:80043318-80043340 GAACATTCCATGCTCATGGATGG + Intergenic
1122531651 14:102431997-102432019 GCCCTTGCCCAGCTCAGGGGTGG - Exonic
1126336012 15:47587136-47587158 GAGCTTTCCCAGCACATGGGAGG + Intronic
1127571016 15:60241678-60241700 GAACATTCCATGCTCATGGATGG + Intergenic
1128570422 15:68729643-68729665 GAACAAGCCCTGCTCTTGAGGGG + Intergenic
1130873597 15:87992740-87992762 CAAGTTGCCCTGTTAATGGGAGG + Intronic
1131728259 15:95251074-95251096 GAAATTGCCCGGCACATAGGAGG - Intergenic
1135049873 16:19184091-19184113 GAAGTTGACCTGGTCAAGGGCGG + Exonic
1136744950 16:32578236-32578258 GAACATTCCATGCTTATGGGTGG + Intergenic
1137080731 16:36049253-36049275 GAATATTCCATGCTCATGGGTGG + Intergenic
1137813192 16:51372767-51372789 GAACATTCCATGCTCATGGATGG + Intergenic
1137907461 16:52337913-52337935 GAACATTCCATGCTCATGGATGG + Intergenic
1203024647 16_KI270728v1_random:496986-497008 GAACATTCCATGCTTATGGGTGG - Intergenic
1203047074 16_KI270728v1_random:837445-837467 GAACATTCCATGCTTATGGGTGG + Intergenic
1147186014 17:38713420-38713442 CAACCTGCCCTCCCCATGGGAGG + Intronic
1148210697 17:45806786-45806808 GGAGTTGCCCTGCTCTTGGAGGG - Intronic
1149983786 17:61332065-61332087 AGCCTCGCCCTGCTCATGGGAGG - Intronic
1150757136 17:67924660-67924682 CAACTCCCCCTGCTGATGGGAGG - Intronic
1151637644 17:75362745-75362767 CAACTTGCTCTGCTCCTGTGTGG + Intronic
1153550865 18:6260404-6260426 AAACATTCCATGCTCATGGGTGG - Intronic
1155385333 18:25271287-25271309 GAACATTCCATGCTCATGGTAGG + Intronic
1157133350 18:45029634-45029656 GAACATTCCATGCTCATGGGTGG - Intronic
1159010877 18:63057822-63057844 GAGCATGCCATCCTCATGGGCGG - Intergenic
1160760398 19:781280-781302 GACTTTGACCTCCTCATGGGAGG - Intergenic
1161023460 19:2023045-2023067 GAACTCAGCCTCCTCATGGGAGG - Intronic
1163388602 19:17015739-17015761 ATCCTTGCCCTGCTCTTGGGTGG - Intronic
1163975290 19:20845507-20845529 GAACGTTCCATGCTCATGGGTGG + Intronic
1164679074 19:30121969-30121991 GAACTTGCCCTGGACAAGGCAGG - Intergenic
1167463034 19:49636287-49636309 GCACCTCCCCTGCTCATGGCCGG - Intronic
925026838 2:615770-615792 GAACTTTCCCTGATCATGTTGGG - Intergenic
925220633 2:2137208-2137230 GAACATTCCATGCTCATGGGTGG + Intronic
925852100 2:8091782-8091804 GATCCTGCCCTTCTCATGGGTGG - Intergenic
926112795 2:10193545-10193567 GAGCCTGTCCTGCTCAGGGGCGG + Intronic
926520752 2:13910374-13910396 GAACATTCCATGCTCATGGGTGG + Intergenic
928396710 2:30948302-30948324 GCCCTTGCCCAGCTCCTGGGAGG + Intronic
928475773 2:31625983-31626005 GAACATTCCATGCTCATGGATGG - Intergenic
928480637 2:31679712-31679734 GAACATTCCATGCTCATGGATGG - Intergenic
929290456 2:40184774-40184796 GAACTTGCCAGGTTCATGCGTGG - Intronic
929554595 2:42917797-42917819 GGACTGGCCTTGCTCATGGTTGG + Intergenic
929732646 2:44512012-44512034 GAACTTTCTCTGCTTGTGGGTGG + Intronic
930688108 2:54330673-54330695 GAACTTGCCCTTCCCATTGTAGG - Intronic
931478036 2:62609734-62609756 AAACATTCCATGCTCATGGGTGG + Intergenic
932431619 2:71678978-71679000 GAACCTGCCCTGCCTAAGGGTGG + Intronic
932525289 2:72459724-72459746 GAACATTCCATGCTCATGGGTGG + Intronic
932983968 2:76703701-76703723 GAACATTCCATGCTTATGGGTGG - Intergenic
934183355 2:89649180-89649202 GAGCTTCCCCTGGCCATGGGGGG + Intergenic
934293637 2:91723351-91723373 GAGCTTCCCCTGGCCATGGGGGG + Intergenic
934812533 2:97294671-97294693 GAACATTCCATGCTCATGGATGG - Intergenic
934825161 2:97413801-97413823 GAACATTCCATGCTCATGGATGG + Intergenic
936096383 2:109533250-109533272 GCACTTGCCCTGCTGCTGGATGG + Intergenic
938109390 2:128553798-128553820 GAGCTTGCTCTGCCCATGTGAGG + Intergenic
940433876 2:153627973-153627995 GAACATTCCATGCTCATGGGTGG - Intergenic
940573286 2:155468242-155468264 GAACATTCCATGCTCATGGGTGG - Intergenic
941487431 2:166099881-166099903 GAACATTCCATGCTCATGGGTGG + Intronic
942124417 2:172809244-172809266 AGACTTGGCCTGCTGATGGGAGG + Intronic
943420350 2:187661167-187661189 GAACATTCCATGCTCATGGGTGG + Intergenic
943628746 2:190226947-190226969 GAACATTCCATGCTCATGGATGG + Intronic
943915943 2:193632663-193632685 GAACATTCCATGCTCATGGATGG + Intergenic
944000896 2:194836213-194836235 GAACATTCCATGTTCATGGGTGG - Intergenic
944393194 2:199241221-199241243 GAACATTCCATGCTCATGGGTGG - Intergenic
947364308 2:229378445-229378467 GACCTTGACCTGCTCAAGGAAGG + Intronic
948074997 2:235159017-235159039 GACCCTGCCCTGCTCAAGGGTGG - Intergenic
948628152 2:239283418-239283440 GCACTGATCCTGCTCATGGGGGG - Intronic
948991019 2:241554056-241554078 GAAGGTGCCCTGCTTCTGGGGGG + Intergenic
1169216518 20:3797382-3797404 CACCTTGCCCTGCTCCTGAGAGG + Intronic
1169616152 20:7447925-7447947 ACACTTCCCATGCTCATGGGTGG - Intergenic
1170462027 20:16586441-16586463 GACCTTGACCTTCTCATGGCGGG + Intergenic
1171814454 20:29772220-29772242 GAACATTCCATGCTCTTGGGTGG + Intergenic
1172620208 20:36313588-36313610 GGACTTGGCCTGCTGCTGGGGGG + Intronic
1172697915 20:36835216-36835238 GACCTTGCCCTCCTCATGCTGGG + Intronic
1173767507 20:45626415-45626437 AAACTTCCCATGCTCATGGATGG - Intronic
1175017595 20:55808540-55808562 GAACATTCCATGCTCATGGGTGG - Intergenic
1175137699 20:56837188-56837210 GAATTTGCCATGCTTCTGGGTGG - Intergenic
1175953016 20:62593543-62593565 GAAATGGCCCTGCTCCTGGTGGG + Intergenic
1176908968 21:14539662-14539684 GAACATTCCATGCTCATGGGTGG + Intronic
1178263863 21:31124518-31124540 GTACCTGCCCTGCTCATGGCCGG + Exonic
1178777520 21:35566246-35566268 CCACATCCCCTGCTCATGGGAGG + Intronic
1180988231 22:19918009-19918031 GTTCATGTCCTGCTCATGGGTGG - Intronic
1181329098 22:22075240-22075262 GGACATGCCCTGGACATGGGAGG - Intergenic
949217928 3:1593503-1593525 GAACTTGAACTGCCCATGGGAGG + Intergenic
951123713 3:18959427-18959449 GAACATTCCATGCTCATGGTAGG - Intergenic
951828616 3:26898553-26898575 GAACATTCCATGCTCATGGTAGG - Intergenic
952879332 3:37973547-37973569 GTACATGTCCTGCTGATGGGTGG + Intronic
953660290 3:44887018-44887040 GCACTTGCCGTGCTCATGGCTGG - Intronic
953776252 3:45819887-45819909 GAAATACCCCTGCCCATGGGTGG - Intergenic
958680925 3:97330440-97330462 GAACATTCCATGCTCATGGGTGG - Intronic
962978000 3:140463114-140463136 GAAAGTGCACTGTTCATGGGAGG - Intronic
963626886 3:147684317-147684339 GAACATACCATGCTCATGGATGG - Intergenic
964193235 3:154030906-154030928 GATCTTGCCCTTCTCATGGAAGG - Intergenic
967508973 3:190288031-190288053 GAACATTCCATGCTCATGGGTGG - Intergenic
967889351 3:194354095-194354117 GGCCCTGCCTTGCTCATGGGAGG + Intergenic
968881724 4:3303581-3303603 GAGCTTGCCCTGGTAGTGGGGGG + Intronic
968978015 4:3831792-3831814 GCACCTGCCCTGCGCATGGGTGG + Intergenic
970020467 4:11561941-11561963 GAACATTCTATGCTCATGGGTGG + Intergenic
970957704 4:21834214-21834236 GAACATTCCATGCTCATGGGTGG - Intronic
971433405 4:26592857-26592879 GAACATTCCATGCTCATGGGTGG + Intronic
971830315 4:31684290-31684312 GAACATTCCATGCTCATGGATGG - Intergenic
974121614 4:57645205-57645227 GAACATTCCATGCTCATGGGAGG - Intergenic
974254511 4:59431743-59431765 GAACATTCCATGCTCATGGATGG + Intergenic
975529120 4:75382626-75382648 GAACATTCCATGCTCATGGATGG + Intergenic
975898145 4:79119562-79119584 GAACATTCCATGCTCATGGATGG + Intergenic
976433613 4:84991763-84991785 GAACATTCCATGCTCATGGGCGG + Intergenic
976684484 4:87796923-87796945 GAACATTCCATGCTCATGGTAGG + Intergenic
977158463 4:93604171-93604193 GAACATTCACTGTTCATGGGAGG + Intronic
977199962 4:94103410-94103432 GAACATTCCATGCTCATGGTAGG + Intergenic
979669698 4:123349119-123349141 GACCTTGCACGGCTCATGAGAGG - Intergenic
981442198 4:144796088-144796110 GAACATTCCATGCTCATGGATGG + Intergenic
981559772 4:146034256-146034278 ACACTTCCCATGCTCATGGGTGG + Intergenic
981685662 4:147451817-147451839 GAACATTCCATGCTCATGGGTGG + Intergenic
981733398 4:147923313-147923335 GACAATGCACTGCTCATGGGGGG - Intronic
981958458 4:150507096-150507118 GAACATTCCATGCTCATGGGTGG + Intronic
982792649 4:159611038-159611060 GAACATTCCATGCTCATGGATGG - Intergenic
983598382 4:169496025-169496047 GAATATTCCATGCTCATGGGTGG - Intronic
983678189 4:170320911-170320933 GAACATTCCATGCTCATGGAAGG + Intergenic
985870328 5:2549262-2549284 GATCTTGCCCAGCTCATGATGGG + Intergenic
987593725 5:19968210-19968232 AAACATTCCATGCTCATGGGTGG + Intronic
988293147 5:29316869-29316891 GAACATTCCATGCTCATGGGTGG - Intergenic
989489088 5:42029975-42029997 GAACATTCCATGCTCATGGGTGG + Intergenic
989569913 5:42936232-42936254 GAACATTCCATGCTTATGGGTGG + Intergenic
989770151 5:45135260-45135282 GAACTTTCCTTGCACATAGGAGG - Intergenic
990882920 5:60559988-60560010 GAACATTCCATGCTCATGGGTGG + Intergenic
991021286 5:61982652-61982674 AAAATTGCCCTGCTCATAGCAGG - Intergenic
994288245 5:97995825-97995847 GAACATTCCATGCTCATGGTAGG + Intergenic
1005699242 6:28383508-28383530 GAACTTGCGCTGCTCAGCTGGGG - Intronic
1005893331 6:30157870-30157892 GACCTTCCCCTGCTCACTGGAGG + Intronic
1006591762 6:35163191-35163213 CAACTTGCCCAGCTCCAGGGGGG + Intergenic
1008269630 6:49475943-49475965 GAACATTCCATGCTCATGGATGG + Intronic
1009246804 6:61248678-61248700 GAATATTCCATGCTCATGGGTGG - Intergenic
1009741097 6:67747159-67747181 GAACATTCCATGCTCATGGATGG - Intergenic
1010675625 6:78739490-78739512 GAACATTCCATGCTCATGGGTGG - Intergenic
1012721713 6:102754511-102754533 GAACATTCCATGCTCATGGGTGG - Intergenic
1012783335 6:103591006-103591028 GAACATTCCATGCTCATGGTAGG - Intergenic
1015365229 6:132389695-132389717 TAACTTGGCCTGCTCATGACTGG + Intronic
1016780937 6:147957135-147957157 GAACATTCCATGCTCAGGGGTGG - Intergenic
1016997249 6:149969459-149969481 GAACATGACCCCCTCATGGGGGG + Intronic
1017001556 6:150000724-150000746 GAACATGACCCCCTCATGGGGGG - Intergenic
1017006849 6:150033643-150033665 GAACATGACCCCCTCATGGGAGG + Intergenic
1017058805 6:150461512-150461534 GAACATTCCATGCTCATGGATGG + Intergenic
1020385951 7:7602593-7602615 GAACATTCCATGCTCATGGGTGG + Intronic
1022619955 7:31972863-31972885 GAAGATGCCAGGCTCATGGGGGG - Intronic
1025106110 7:56173604-56173626 GACATTGCCCTGGTCATGGTAGG - Intergenic
1028767236 7:94573349-94573371 AAACTTCCCATGCTCATGGACGG - Intergenic
1032772268 7:135071240-135071262 GAACATTCCATGCTCATGGGTGG + Intronic
1034394589 7:150812075-150812097 GAACATTCCCTGCTCATGGATGG + Intergenic
1034528296 7:151679748-151679770 GATCATGCCCTGCTCAGGGATGG - Intronic
1034538658 7:151742004-151742026 ATACCTGCCCTGCTCATGTGTGG - Intronic
1036117685 8:5976532-5976554 GAACTTGCCGTCCACTTGGGTGG - Intergenic
1036139655 8:6195595-6195617 GAACATTCCATGCTCATGGGTGG + Intergenic
1036745315 8:11403680-11403702 GAACATTCAATGCTCATGGGTGG - Intronic
1037987710 8:23299985-23300007 GTACATGCCCTGCTCCGGGGCGG + Intronic
1038517255 8:28197508-28197530 GAACAAGCCCAGCTGATGGGAGG - Intergenic
1039103252 8:33963352-33963374 GAACATTCCATGCTCATGGGTGG - Intergenic
1041606042 8:59783374-59783396 TAACATGCCTTGCTCATAGGTGG - Intergenic
1042931689 8:74020438-74020460 GAACATTCCATGCTCATGGATGG + Intronic
1043182866 8:77107213-77107235 GAACATTCCATGCTCATGGATGG + Intergenic
1043747442 8:83892726-83892748 GAACATTCCAAGCTCATGGGTGG + Intergenic
1046231024 8:111358552-111358574 GAGTGTGCCCTGCTCTTGGGGGG + Intergenic
1048101404 8:131356350-131356372 AAACATTCCATGCTCATGGGTGG - Intergenic
1049094111 8:140538309-140538331 GACCTTGACCTGGTCAAGGGAGG - Intronic
1050401095 9:5255836-5255858 GAACATTCCATGCTCATGGATGG - Intergenic
1051129395 9:13842322-13842344 TAACTTGCCTTGATCATGGCAGG - Intergenic
1051315195 9:15821702-15821724 GAACATTCCATGCTCCTGGGTGG + Intronic
1051349864 9:16188894-16188916 GAACATTCCATGCTCATGGGTGG - Intergenic
1051836598 9:21345328-21345350 AAACTTTCCATGCTCATGGTAGG + Intergenic
1052010212 9:23398705-23398727 GAACATTTCATGCTCATGGGTGG + Intergenic
1060395160 9:123311424-123311446 GACATGGCCCTGCTCATGGAAGG + Intergenic
1062099115 9:134718858-134718880 GACCTTGCCTTCCTCCTGGGGGG + Intronic
1062712782 9:137985794-137985816 GACCGTGCCCTGCTCATGCACGG - Intronic
1186230896 X:7452455-7452477 GAACATTTCATGCTCATGGGTGG + Intergenic
1187835140 X:23424917-23424939 GAACATTCTATGCTCATGGGTGG - Intergenic
1189305894 X:39986426-39986448 TAAACTGCCCTGCCCATGGGTGG - Intergenic
1190147069 X:47903579-47903601 GAAGATTCCATGCTCATGGGTGG + Intronic
1190163995 X:48056415-48056437 GAACATGGCCTGCTCAAGGTGGG + Intronic
1190494367 X:51014278-51014300 GAACATTCCATGCTCATGGGTGG - Intergenic
1191592473 X:62902899-62902921 GAACATTCCATGCTCATGGGTGG - Intergenic
1191747607 X:64507075-64507097 GAACATTCCATGCTCATGGGTGG + Intergenic
1191814524 X:65228902-65228924 GAACATTCCATGCTCATGGGTGG + Intergenic
1191836070 X:65463367-65463389 AAACATCCCATGCTCATGGGTGG - Intronic
1192135075 X:68589407-68589429 GAACTTGCCCTGGACAAGAGAGG + Intergenic
1193346438 X:80409615-80409637 GAACATTCCATGCTCATGGGTGG + Intronic
1193632694 X:83909537-83909559 GAACATTCCATGCTCATGGTAGG + Intergenic
1197297629 X:124738422-124738444 GAATTTGTCATGCTCTTGGGAGG - Intronic
1200778421 Y:7191646-7191668 GAACATTCCATGCTCATGGATGG - Intergenic