ID: 924825367

View in Genome Browser
Species Human (GRCh38)
Location 1:247532651-247532673
Sequence ACAATTTCACTGTGTTGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 36619
Summary {0: 1, 1: 16, 2: 471, 3: 5180, 4: 30951}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924825367 Original CRISPR ACAATTTCACTGTGTTGCCC GGG Intronic
Too many off-targets to display for this crispr