ID: 924826803

View in Genome Browser
Species Human (GRCh38)
Location 1:247548310-247548332
Sequence CAGAGCCACAAAGCACAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 222}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924826803_924826808 -8 Left 924826803 1:247548310-247548332 CCAGCTTGTGCTTTGTGGCTCTG 0: 1
1: 0
2: 0
3: 19
4: 222
Right 924826808 1:247548325-247548347 TGGCTCTGGTGGGCAGCCTAGGG 0: 1
1: 0
2: 1
3: 17
4: 214
924826803_924826817 24 Left 924826803 1:247548310-247548332 CCAGCTTGTGCTTTGTGGCTCTG 0: 1
1: 0
2: 0
3: 19
4: 222
Right 924826817 1:247548357-247548379 GGGGACCAGATGCTGGCAACAGG 0: 1
1: 0
2: 1
3: 16
4: 182
924826803_924826811 2 Left 924826803 1:247548310-247548332 CCAGCTTGTGCTTTGTGGCTCTG 0: 1
1: 0
2: 0
3: 19
4: 222
Right 924826811 1:247548335-247548357 GGGCAGCCTAGGGGAGGAAGTGG 0: 1
1: 1
2: 13
3: 84
4: 616
924826803_924826814 5 Left 924826803 1:247548310-247548332 CCAGCTTGTGCTTTGTGGCTCTG 0: 1
1: 0
2: 0
3: 19
4: 222
Right 924826814 1:247548338-247548360 CAGCCTAGGGGAGGAAGTGGGGG 0: 1
1: 0
2: 7
3: 51
4: 477
924826803_924826816 17 Left 924826803 1:247548310-247548332 CCAGCTTGTGCTTTGTGGCTCTG 0: 1
1: 0
2: 0
3: 19
4: 222
Right 924826816 1:247548350-247548372 GGAAGTGGGGGACCAGATGCTGG 0: 1
1: 0
2: 1
3: 28
4: 299
924826803_924826813 4 Left 924826803 1:247548310-247548332 CCAGCTTGTGCTTTGTGGCTCTG 0: 1
1: 0
2: 0
3: 19
4: 222
Right 924826813 1:247548337-247548359 GCAGCCTAGGGGAGGAAGTGGGG 0: 1
1: 0
2: 6
3: 41
4: 433
924826803_924826807 -9 Left 924826803 1:247548310-247548332 CCAGCTTGTGCTTTGTGGCTCTG 0: 1
1: 0
2: 0
3: 19
4: 222
Right 924826807 1:247548324-247548346 GTGGCTCTGGTGGGCAGCCTAGG No data
924826803_924826809 -7 Left 924826803 1:247548310-247548332 CCAGCTTGTGCTTTGTGGCTCTG 0: 1
1: 0
2: 0
3: 19
4: 222
Right 924826809 1:247548326-247548348 GGCTCTGGTGGGCAGCCTAGGGG 0: 1
1: 0
2: 0
3: 32
4: 230
924826803_924826812 3 Left 924826803 1:247548310-247548332 CCAGCTTGTGCTTTGTGGCTCTG 0: 1
1: 0
2: 0
3: 19
4: 222
Right 924826812 1:247548336-247548358 GGCAGCCTAGGGGAGGAAGTGGG 0: 1
1: 0
2: 4
3: 47
4: 347
924826803_924826810 -4 Left 924826803 1:247548310-247548332 CCAGCTTGTGCTTTGTGGCTCTG 0: 1
1: 0
2: 0
3: 19
4: 222
Right 924826810 1:247548329-247548351 TCTGGTGGGCAGCCTAGGGGAGG 0: 1
1: 0
2: 0
3: 20
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924826803 Original CRISPR CAGAGCCACAAAGCACAAGC TGG (reversed) Intronic
900288834 1:1915253-1915275 CTGAGCCACTGAGCACCAGCTGG + Exonic
900373144 1:2341168-2341190 CAGATCCACAAAGGGGAAGCTGG - Intronic
901599185 1:10409259-10409281 CAAAGCCACCAAGCACTGGCAGG - Intronic
901698002 1:11024350-11024372 CAGAGGCACTAAGAAAAAGCCGG - Exonic
901847978 1:11996637-11996659 CAGAGACACACAGCAAATGCAGG - Intronic
902060563 1:13638627-13638649 CTGAGCCACAAAGCGAAAGGTGG + Intergenic
902694568 1:18131715-18131737 CAGAGCCACAAGACAGAAGGAGG - Intronic
902963172 1:19978860-19978882 CAGAGCCACCAAGGAGGAGCAGG - Exonic
903602618 1:24553720-24553742 CTGAGACCCAAAGGACAAGCAGG - Intergenic
905026115 1:34850914-34850936 AAGAACCAAGAAGCACAAGCTGG - Intronic
905167012 1:36088732-36088754 CCGAGACTCAAAGCACAGGCTGG + Intergenic
905876510 1:41435171-41435193 CAGAGTCACACAGCAGAACCAGG - Intergenic
906045832 1:42830411-42830433 CAGAGGGAGACAGCACAAGCGGG - Intronic
906841254 1:49141975-49141997 CTGAGCCACACAGCACGAGGTGG + Intronic
907965793 1:59328110-59328132 CAAAGCTTCAAAGGACAAGCTGG - Intronic
910086302 1:83406797-83406819 CAGAGGCACAAAGCATGGGCAGG + Intergenic
912262179 1:108121457-108121479 CCGCGGCACAAACCACAAGCGGG - Intergenic
912564110 1:110572895-110572917 CAGAGGCAGAGAGGACAAGCTGG - Intergenic
912760207 1:112359710-112359732 CAGAGCCACAAAGAACAGGAAGG + Intergenic
913200383 1:116491196-116491218 CAGACCCATAGGGCACAAGCTGG - Intergenic
915634270 1:157175392-157175414 CAGAGCCACAATGCAGAATTGGG + Intergenic
918443162 1:184588934-184588956 CAGAGGCTCAATGGACAAGCAGG - Intronic
921718348 1:218442608-218442630 AAGAAACACAAAGCACAAGTAGG - Exonic
921758141 1:218882661-218882683 CACAACCCCAACGCACAAGCAGG + Intergenic
921892096 1:220364089-220364111 CAGAGCCAGAGAGCACTAGATGG - Intergenic
922572957 1:226644573-226644595 CAGAGCCACTGAGCACATGTCGG + Intronic
923407399 1:233676199-233676221 CAGAGCCACAAACCACACACAGG + Intergenic
924826803 1:247548310-247548332 CAGAGCCACAAAGCACAAGCTGG - Intronic
1064032944 10:11894584-11894606 CAGAGCCGAAAGGCCCAAGCAGG + Intergenic
1065996855 10:31067537-31067559 GAGAGCCTCACAGCACAGGCTGG + Intergenic
1066015846 10:31242765-31242787 CATAAGCACAAAGCAGAAGCTGG + Intergenic
1070373031 10:75803502-75803524 CAGAGCCAGAATGTACATGCAGG - Intronic
1070563458 10:77585258-77585280 CAGCCCCACAACGCACTAGCCGG + Intronic
1071429416 10:85595019-85595041 CAGAGCCAAAATGCAAAAGCAGG + Intergenic
1072032740 10:91537030-91537052 AAGAGCCACAGAGCCCAAGAAGG + Intergenic
1072784497 10:98270411-98270433 CAGAGCCACAATCAACCAGCAGG + Intergenic
1072827377 10:98621134-98621156 AAAAGCCACAAATCACAAGAAGG + Intronic
1073786985 10:106900447-106900469 CAGAGTCAGACAGCACATGCAGG + Intronic
1074530676 10:114296885-114296907 AAAAGCCACAAAGCACCACCTGG + Intronic
1077206846 11:1348904-1348926 CACACACACAAAGCACTAGCTGG + Intergenic
1077555797 11:3225485-3225507 CAGAGCCACAAGGCCCCACCAGG - Intergenic
1077563568 11:3281719-3281741 GAGAGGGACAAAGCACAAGTAGG - Intergenic
1077569458 11:3327534-3327556 GAGAGGGACAAAGCACAAGTAGG - Intergenic
1079097340 11:17519330-17519352 CAGCTCCACAAAGCACAGGATGG - Intronic
1079245419 11:18748928-18748950 CAGAGCCCAAAAGAACAAACGGG - Intronic
1079483784 11:20912289-20912311 CTGAGACACAGAACACAAGCTGG + Intronic
1080350722 11:31382873-31382895 CAGAGGCACATATCACAACCTGG - Intronic
1081200599 11:40210564-40210586 CAGAGCCACGTAGCCCAAGAAGG - Intronic
1081435675 11:43024912-43024934 CAGAGCCACAACTCACACCCAGG - Intergenic
1081842307 11:46211500-46211522 CAGACCCGCAAAGCACATGGGGG - Intergenic
1083126461 11:60572342-60572364 CAGTGCCACATAGCACAGGGAGG + Intergenic
1083273784 11:61585756-61585778 CAGGGCCCCAAAGCAGAACCTGG - Intergenic
1085551024 11:77372186-77372208 TTGAGCCACAAAGCACAATTCGG + Intronic
1088373057 11:109112385-109112407 CAGGGCCCCACAGTACAAGCTGG + Intergenic
1090225505 11:125069891-125069913 CAGAGCCACAGAGCACCTGGAGG + Intronic
1091002027 11:131917790-131917812 CAGAGCCACAGGACACCAGCCGG - Intronic
1091178899 11:133585598-133585620 CTGAGCCACAAAGTAGAAGAGGG - Intergenic
1091957744 12:4661750-4661772 CAGATGAACAAAGAACAAGCAGG + Intronic
1092249390 12:6884180-6884202 CATCACTACAAAGCACAAGCTGG + Intronic
1093683089 12:22024966-22024988 CAGAACAAAAAAGCAGAAGCAGG + Intergenic
1096542385 12:52314990-52315012 CAAAGTCACAAAGCAGAACCAGG - Intronic
1101874370 12:108589096-108589118 CAGAGCCACGCAGCACACACAGG + Intergenic
1102150863 12:110688624-110688646 CAGAGCCAGAACTCACAACCAGG - Exonic
1103624126 12:122205711-122205733 CAAAGCCACACACCACAAGAGGG - Intronic
1104609236 12:130215056-130215078 CAGAACCAAAAAGCAAAACCAGG + Intergenic
1104860957 12:131923283-131923305 CAGAGCCCCAGGGCAGAAGCTGG + Intergenic
1107290083 13:38842083-38842105 CAGAGCCATAGAGCAAAGGCTGG + Intronic
1114693541 14:24606879-24606901 GAGAGCCAGAAAGCACAGCCAGG - Intronic
1115579710 14:34745909-34745931 CACACCAACAAAGAACAAGCAGG - Intergenic
1116721034 14:48495740-48495762 CAAAAACACAAAGAACAAGCTGG - Intergenic
1117008811 14:51449488-51449510 CAAAGCCACAAAGAAGGAGCTGG + Intergenic
1119715883 14:76859043-76859065 AAGAGCCAGGAAGCACAAGAAGG - Intronic
1124251681 15:28110308-28110330 CAGAGCCACTCAGCAGAGGCCGG + Intergenic
1124694928 15:31856821-31856843 CAGAGCCAGAAATGACAATCTGG - Intronic
1124832208 15:33160134-33160156 CAGATCCACAATCCACAGGCTGG - Intronic
1125420215 15:39497566-39497588 CAGAGCAGCAAAGCACAAGAGGG + Intergenic
1129869202 15:78929919-78929941 CAGGGCCACACAGCTAAAGCTGG + Intronic
1132047185 15:98574053-98574075 CAGAACCACCAAGCAAAAGTAGG - Intergenic
1132682759 16:1150130-1150152 CAGAGCCCCCAAGGACAAGGTGG + Intergenic
1133530720 16:6652722-6652744 CAGAGACAGAAAGCAGAAGGTGG + Intronic
1135228344 16:20681370-20681392 CAGAGCTAGAATGCACAAGTTGG + Intronic
1137686191 16:50388591-50388613 CAGTGCCACAGAGCACATGTGGG - Intergenic
1137768680 16:50997142-50997164 CAGTGCCCCAAAGGACAGGCCGG - Intergenic
1140280087 16:73545999-73546021 CAGAAACACAAAGCATCAGCGGG + Intergenic
1140855575 16:78975066-78975088 CAGAGTAACAAGGCAAAAGCAGG - Intronic
1141060564 16:80863518-80863540 CAGAAGCACAAAGCAAAAGGGGG + Intergenic
1143473646 17:7191288-7191310 CAGAGCCACCAAGCTGGAGCAGG - Exonic
1143891060 17:10102829-10102851 GAGAGCCACAAATCCCAAACAGG + Intronic
1144748073 17:17628963-17628985 CAGACCAACAAGGAACAAGCAGG - Intergenic
1145050627 17:19657353-19657375 CAGAGCCAAAAGCCACAACCAGG + Intronic
1149311453 17:55398038-55398060 GAGATCCACAAAGCACGAGGAGG - Intronic
1149779772 17:59388126-59388148 CAGAGCCACAAAGCTCGATCTGG - Intronic
1152382172 17:79947702-79947724 CAAACCCACAAAGCACCAGAAGG + Exonic
1152519279 17:80845867-80845889 CAGAGCCACAAACCAGCACCGGG - Intronic
1153204302 18:2680476-2680498 CAGAGCCCCTCAGCAAAAGCTGG - Intronic
1154349732 18:13572939-13572961 CAGAGCCATCAAGCACATCCTGG - Intronic
1156035809 18:32767636-32767658 CAGAGCCAGCAGGCACTAGCTGG + Intronic
1159729257 18:72004613-72004635 GAGAGACACAAAGCAGAAGCAGG + Intergenic
1160910876 19:1473351-1473373 CAGAGCCAGAAAGCAGAAACTGG + Exonic
1161000918 19:1910363-1910385 CAGAGCCTGGAAGCAGAAGCGGG - Intronic
1164677622 19:30112310-30112332 CAGGGCCACACAGCACAGGAGGG - Intergenic
1165304447 19:34995032-34995054 CACAGCCACAGAGCAGAAACTGG + Intronic
1166919234 19:46217513-46217535 CAGAGACACAGAGCACAAGATGG + Intergenic
1167266201 19:48483928-48483950 CAGAGCCACAAAGACAAACCCGG + Intergenic
1167601192 19:50455750-50455772 TACAGACACAAAACACAAGCAGG - Intronic
1168350570 19:55673660-55673682 CAGAGCCATAGAGCGCAGGCGGG - Intronic
924977016 2:187118-187140 GAGAACCACAGAGCACAAGATGG - Intergenic
927862577 2:26569395-26569417 CTGTGACACCAAGCACAAGCGGG - Intronic
930311392 2:49745047-49745069 CAGAACCATAAAGCAGAAGAAGG + Intergenic
931759735 2:65406192-65406214 CAGAGCCACAAAGACCCTGCTGG + Intronic
934026320 2:88004464-88004486 CACAGCCAAAAAGTACAGGCAGG + Intergenic
935555739 2:104508027-104508049 CTGAGCCACAGAGCACACGTGGG - Intergenic
935934362 2:108165870-108165892 CAAAGCCACAGAGAGCAAGCGGG + Intergenic
937220488 2:120340439-120340461 CTGAGCCATGAAGCACAAGGAGG - Intergenic
937379087 2:121360095-121360117 CAGAGCCACAGTGCACATGCTGG + Intronic
939766797 2:146260693-146260715 CAGAGCCATGAAGCCCAAGTAGG - Intergenic
940861410 2:158773979-158774001 CAAAACCACAGAGCACAACCTGG + Intergenic
941095961 2:161239279-161239301 CAGGGCCACAAAGGCCAAGAAGG + Intergenic
944098806 2:195999223-195999245 CAGAGAAACAAAGCAAAACCAGG - Intronic
944932898 2:204538473-204538495 CACAGCCAGAAAACACAACCAGG - Intergenic
945921581 2:215760688-215760710 CAGAGGCCCAAAACACAAGCTGG + Intergenic
947756536 2:232569912-232569934 CAAAGCCACAAAGCACACAAGGG - Intronic
948117623 2:235505344-235505366 CAGAGCCAGGAAGGACACGCGGG + Intronic
949052355 2:241903974-241903996 CCCTGCCACAAAGCACAAGGTGG + Intergenic
1170053981 20:12178573-12178595 CTGAGCCACAAAGGACTACCCGG + Intergenic
1170628788 20:18050404-18050426 CAGAGCCACAGAGCAGAACTGGG - Intronic
1172347282 20:34211884-34211906 AAATGCCACAAAGCCCAAGCAGG - Intronic
1172498286 20:35405151-35405173 CAGAGCCCCAAAGCAAAAACTGG + Intronic
1172970589 20:38870564-38870586 CAGAACAAAATAGCACAAGCAGG + Intronic
1173089346 20:39955441-39955463 CAGAGCCACAACTCAAAAGAGGG - Intergenic
1173506880 20:43594459-43594481 AAGAGGCAGAAAGCAAAAGCGGG + Intronic
1173991708 20:47308730-47308752 CACAGCCACGGAGCAAAAGCAGG + Intronic
1174157768 20:48527915-48527937 CAGAGGGACAGAGGACAAGCAGG + Intergenic
1174254257 20:49242589-49242611 CACAGCCAAGAAGCAAAAGCAGG + Exonic
1176057013 20:63154396-63154418 CAGGGCCACCAAGAACAGGCAGG + Intergenic
1176191193 20:63810917-63810939 CAGAGCCGGAGAGCACCAGCTGG + Intronic
1178974527 21:37209596-37209618 AAGAGCCACACCCCACAAGCTGG + Intergenic
1179597214 21:42451012-42451034 CACAGCCACAAATCCCAAGAAGG + Intergenic
1179598535 21:42460360-42460382 CAGAGCCTCAGATCACAAGGGGG - Intergenic
1180229212 21:46416525-46416547 CAGAGCCACACTGCAGAGGCTGG + Exonic
1180703548 22:17794858-17794880 CAGAACCACAGAGCACACACAGG + Intronic
1181177824 22:21047746-21047768 CAGAGCCTAAAAGGAGAAGCAGG + Intronic
1183162466 22:36124042-36124064 CAGAGGCACAAAGCCGGAGCAGG - Intergenic
1184475641 22:44719894-44719916 CAGGGCCAGAAAGCAGAGGCTGG - Intronic
1184897976 22:47423368-47423390 CAGAGCCACTGAGCACGAGGCGG - Intergenic
1185171651 22:49297932-49297954 CAGAGCCTGGAAGAACAAGCTGG + Intergenic
951436013 3:22665696-22665718 CAGAGCCATAAACCACGTGCAGG - Intergenic
954423344 3:50430352-50430374 CTGAGCCACACAGCACAGGATGG + Intronic
954503271 3:51041910-51041932 CAAAGCATCAAAGGACAAGCTGG - Intronic
954563841 3:51581617-51581639 CAGAGCCACAGAGCTCAGTCTGG - Intronic
955413510 3:58671340-58671362 AAGAGCCACACAACACAACCGGG - Intergenic
958069726 3:88594536-88594558 CAGAGCAATAAAGCAATAGCAGG + Intergenic
960193730 3:114739471-114739493 CAGAGCCACAGAGGAGGAGCTGG - Intronic
960524590 3:118695262-118695284 CAGAGACACAAGGAAGAAGCAGG + Intergenic
960547982 3:118938916-118938938 CAGAGCTTCAAAGTACAAGAAGG + Intronic
961494096 3:127278340-127278362 CAAAGCCTCAAAGCACACTCTGG + Intergenic
962716263 3:138128736-138128758 GAGAGCCACAAAGACCAAGCTGG + Intronic
965423244 3:168488681-168488703 CAGAGTTAGAAATCACAAGCTGG - Intergenic
965900790 3:173639203-173639225 CTGAGCCAGAAAGAACATGCAGG - Intronic
967929944 3:194683735-194683757 GAGAGCCAAAAAACACAATCAGG + Intergenic
968588957 4:1448348-1448370 AAGACCCACAAAGCACAGGCTGG - Intergenic
969579783 4:8058032-8058054 CAGAACCTCACAGCAGAAGCGGG + Intronic
969930429 4:10625789-10625811 CAGAGTCAGAAAGCAGAAACTGG + Intronic
973981661 4:56313304-56313326 CAGTGCCGCCAAGCACAAGCTGG + Exonic
974274424 4:59699234-59699256 CAGAGTTAGAAAGCACAATCAGG - Intergenic
975735027 4:77372685-77372707 CAGAGCTACAACTCACAAGTGGG - Intronic
985513507 5:325200-325222 CAGAGCCACAGGGCAAGAGCGGG - Intronic
985918812 5:2949808-2949830 GAGCGCCCCAAATCACAAGCAGG - Intergenic
988940249 5:36138740-36138762 CAGATCAACAAGGCAGAAGCTGG + Intronic
992886542 5:81165701-81165723 CAGAGGCACACAGGACCAGCAGG - Intronic
995774956 5:115715169-115715191 CAGAGCCACATAGTGCATGCTGG - Intergenic
996915131 5:128703244-128703266 CAGCTCCAGACAGCACAAGCAGG + Intronic
997074068 5:130651490-130651512 GAGAGGCAGAAAGCAGAAGCTGG + Intergenic
997892875 5:137690525-137690547 CAGAGCCAGAAAGAATCAGCAGG + Intronic
999223834 5:150003394-150003416 CAAGGCCACCAAGCCCAAGCAGG - Intronic
1003604288 6:7544801-7544823 CAAAGACACAAAGAACAGGCAGG - Intronic
1004158893 6:13195953-13195975 CAGAGCCATAAAACCCAAGAGGG - Intronic
1006424934 6:33958093-33958115 CATAGCCACAGAACACAACCAGG + Intergenic
1007684151 6:43655429-43655451 CAGAGCCACACAGATCACGCTGG - Intronic
1009975845 6:70669352-70669374 CTGAGCCACACAGCATCAGCAGG + Intronic
1011753670 6:90477960-90477982 CAGAGACACAAAGAAGAAACAGG + Intergenic
1013838612 6:114362568-114362590 AAAAGCCACAAAGCACGAGATGG + Intergenic
1015891941 6:137978175-137978197 CAGAAGCACAAACCATAAGCTGG + Intergenic
1018174913 6:161170123-161170145 TGGAACCACCAAGCACAAGCGGG - Intronic
1018790897 6:167146926-167146948 AAGAGGCACAAAGCACACGAGGG + Intronic
1018995453 6:168706625-168706647 CAGAGCAACCAAGAACACGCAGG - Intergenic
1019685625 7:2380339-2380361 CAGAGCCAGAGAGCACAGGGAGG - Exonic
1020408918 7:7868512-7868534 GAGAACCACGGAGCACAAGCAGG + Intronic
1020484651 7:8706330-8706352 CAGATTCAGAAGGCACAAGCAGG + Intronic
1022195880 7:28066934-28066956 CAGAGCCAAGAAGAACTAGCAGG + Intronic
1022310660 7:29194004-29194026 CAGAGCAACAAAGGACAATTTGG + Intronic
1024096274 7:45985296-45985318 CAGCCACACAAAGCACCAGCAGG + Intergenic
1024922113 7:54569043-54569065 CAAAGCCACAAACAAGAAGCAGG - Exonic
1027216145 7:76185322-76185344 GAGAGACACAAAGCACACGCAGG - Intergenic
1027303180 7:76863261-76863283 CAGAGGCACAAAGCATGGGCAGG + Intergenic
1027446384 7:78278398-78278420 CAGATCCACAAAACACAAGGCGG - Intronic
1027717037 7:81685447-81685469 CAGAGACAGAAAACACAAGAAGG - Intergenic
1028621963 7:92835600-92835622 CAGAGACAGAAAGCAGAAGGAGG - Intronic
1028721409 7:94036515-94036537 CAGGGCCACAGAACACAAGGTGG - Intergenic
1029177948 7:98678251-98678273 CAGTTCCACAAATCACAGGCAGG - Intergenic
1029633578 7:101768749-101768771 CAGAGCCACAAAGCAGGAGTGGG - Intergenic
1034816732 7:154178402-154178424 CAAAGCCAAAAACCACAAGAAGG + Intronic
1035053773 7:156020083-156020105 CAGAGCCAAGAAGCACATGTGGG + Intergenic
1035077551 7:156190871-156190893 AAGAACCACAGGGCACAAGCAGG - Intergenic
1035238288 7:157514412-157514434 CAGAGCCCCAAAGCACAGGGCGG - Intergenic
1035387146 7:158481090-158481112 CAAAGCTTCAAAGCACAGGCTGG + Intronic
1035469247 7:159099308-159099330 CAGAGCCACTATGCTCACGCAGG + Intronic
1035565404 8:637554-637576 CAGAGCCAGACAGCAGGAGCTGG - Intronic
1035588610 8:796279-796301 CAGGGACACAAAGTCCAAGCGGG - Intergenic
1036469810 8:9042581-9042603 CAGGGCCACAAAGCCCCAGAAGG - Intronic
1038045607 8:23763394-23763416 CAGAGACACAAAGCAGAACAGGG - Intergenic
1042954654 8:74236838-74236860 CAAAGCCACAAAGCACTCCCAGG + Exonic
1043622571 8:82213683-82213705 AAGAACCACAGAGAACAAGCTGG - Intergenic
1044616107 8:94143499-94143521 CAAAGCCTCAAAGGACAGGCTGG - Intronic
1044622383 8:94202937-94202959 CAGAGCTAAAAAGCCCAAGAAGG - Intronic
1045073114 8:98531599-98531621 CAGAGCTTCAAAGGACAGGCTGG - Intronic
1045904834 8:107332470-107332492 CAGAAGCACAAAGCAGAAACAGG - Intronic
1047618072 8:126579807-126579829 CATATCCACAGAGCACAAGGTGG - Intergenic
1048198806 8:132354528-132354550 CAGAGCCACTAAGACCAGGCAGG + Intronic
1049070372 8:140351019-140351041 CAGGGCGAGAAAGCAGAAGCAGG + Intronic
1050822769 9:9901839-9901861 CAGAGCCAGAGAGCAAGAGCAGG + Intronic
1051576819 9:18625306-18625328 CAGAGGAACAAAGCAAAAACAGG + Intronic
1051974907 9:22937759-22937781 CAGAGCGTCAAAGCCCAAGGAGG - Intergenic
1052042241 9:23752223-23752245 CAGAGTCAAAAAGCACACACAGG + Intronic
1052802303 9:32980390-32980412 CAGAGCCACATTGGACAAGGTGG - Intronic
1055594276 9:77849623-77849645 CAGTTCCACAAAGCAAGAGCTGG + Intronic
1057465236 9:95307963-95307985 CACAGCGACAGAGCACAAGAGGG + Intronic
1059325417 9:113501402-113501424 CAGAGGCACACAGCACAGACAGG + Intronic
1059378885 9:113907978-113908000 GAGACCCACAAAGCACTAGATGG - Intronic
1060033712 9:120237024-120237046 CACAGCCATTAAGCTCAAGCAGG + Intergenic
1061177890 9:129008475-129008497 CAGAGCCACAGGTCAGAAGCAGG + Exonic
1061712615 9:132498491-132498513 CAGGGTCACACAGCAGAAGCGGG - Intronic
1062150704 9:135017371-135017393 CAGAGCCTCAAAGCCCAACCAGG - Intergenic
1062302765 9:135884798-135884820 CAGAGCCACCCCGCACACGCCGG + Intronic
1186332428 X:8548992-8549014 CTGGGCCACAAAGGAGAAGCTGG - Intronic
1186796481 X:13051207-13051229 CAGAGAGAGAAAGAACAAGCTGG + Intergenic
1189481849 X:41398067-41398089 CAGAGATCCAAAGCACAAGAAGG - Intergenic
1195399744 X:104448474-104448496 GACAGGCACAATGCACAAGCAGG - Intergenic
1195779022 X:108440154-108440176 CAGGGCCAGTAAGAACAAGCCGG - Exonic
1196648208 X:118140782-118140804 CAAAGACATAAAGAACAAGCTGG - Intergenic
1199008530 X:142731148-142731170 CAGGTCCTGAAAGCACAAGCAGG + Intergenic
1201573355 Y:15436828-15436850 CACAGCTAGAATGCACAAGCTGG + Intergenic