ID: 924828724

View in Genome Browser
Species Human (GRCh38)
Location 1:247570055-247570077
Sequence ACACACTAAAAAATAATAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7732
Summary {0: 1, 1: 2, 2: 100, 3: 3333, 4: 4296}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924828724_924828727 22 Left 924828724 1:247570055-247570077 CCCTCTATTATTTTTTAGTGTGT 0: 1
1: 2
2: 100
3: 3333
4: 4296
Right 924828727 1:247570100-247570122 TTCATTATTAGTCTGGCTAGTGG 0: 2
1: 568
2: 5884
3: 2786
4: 1941
924828724_924828726 15 Left 924828724 1:247570055-247570077 CCCTCTATTATTTTTTAGTGTGT 0: 1
1: 2
2: 100
3: 3333
4: 4296
Right 924828726 1:247570093-247570115 GTCTTTCTTCATTATTAGTCTGG 0: 1
1: 1
2: 13
3: 136
4: 1388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924828724 Original CRISPR ACACACTAAAAAATAATAGA GGG (reversed) Intronic
Too many off-targets to display for this crispr