ID: 924829092

View in Genome Browser
Species Human (GRCh38)
Location 1:247573484-247573506
Sequence GAGGGTGAACAGAAGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2763
Summary {0: 7, 1: 160, 2: 436, 3: 780, 4: 1380}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924829092_924829101 24 Left 924829092 1:247573484-247573506 CCACCCTGCTTCTGTTCACCCTC 0: 7
1: 160
2: 436
3: 780
4: 1380
Right 924829101 1:247573531-247573553 CAGTCCCAATGAGATGAACTGGG 0: 120
1: 697
2: 1037
3: 772
4: 892
924829092_924829100 23 Left 924829092 1:247573484-247573506 CCACCCTGCTTCTGTTCACCCTC 0: 7
1: 160
2: 436
3: 780
4: 1380
Right 924829100 1:247573530-247573552 CCAGTCCCAATGAGATGAACTGG 0: 152
1: 412
2: 383
3: 237
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924829092 Original CRISPR GAGGGTGAACAGAAGCAGGG TGG (reversed) Intronic
Too many off-targets to display for this crispr