ID: 924829694

View in Genome Browser
Species Human (GRCh38)
Location 1:247579935-247579957
Sequence GACCTAAGCATTCTTCCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 4, 3: 15, 4: 132}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924829694_924829697 20 Left 924829694 1:247579935-247579957 CCAGAGGGAAGAATGCTTAGGTC 0: 1
1: 0
2: 4
3: 15
4: 132
Right 924829697 1:247579978-247580000 TGTTAAACTGGAAATTGAGACGG 0: 1
1: 0
2: 1
3: 24
4: 291
924829694_924829698 28 Left 924829694 1:247579935-247579957 CCAGAGGGAAGAATGCTTAGGTC 0: 1
1: 0
2: 4
3: 15
4: 132
Right 924829698 1:247579986-247580008 TGGAAATTGAGACGGCCACCTGG 0: 1
1: 0
2: 7
3: 71
4: 366
924829694_924829696 8 Left 924829694 1:247579935-247579957 CCAGAGGGAAGAATGCTTAGGTC 0: 1
1: 0
2: 4
3: 15
4: 132
Right 924829696 1:247579966-247579988 AAACAACGTTTCTGTTAAACTGG 0: 1
1: 0
2: 1
3: 24
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924829694 Original CRISPR GACCTAAGCATTCTTCCCTC TGG (reversed) Intergenic
900800977 1:4736928-4736950 GGCCTGAGAATTCTTCCCTGCGG + Intronic
902769076 1:18635219-18635241 GACCGAAGCACTGTGCCCTCAGG + Exonic
903030259 1:20458974-20458996 CACATCAGCATTCTACCCTCTGG - Intergenic
908697986 1:66866376-66866398 TACCTAAGTATTCTGTCCTCAGG + Intronic
912142091 1:106743037-106743059 GACCTTAAAATTCTTCCTTCTGG + Intergenic
913491597 1:119384918-119384940 AACCTAGGGATTCTACCCTCTGG - Exonic
916385150 1:164258765-164258787 GACCTTAGCATGTTTCCCTGAGG - Intergenic
921121087 1:212138412-212138434 GACCTATGTATTCTGCCCACTGG - Intergenic
921728429 1:218550091-218550113 TCCCTAAGCATTCTTTTCTCAGG + Intergenic
922588223 1:226751939-226751961 AACCTCAGCATTCATGCCTCAGG - Intergenic
922653211 1:227358711-227358733 GACCCAAGTATTCTTCCCAATGG + Intergenic
923925985 1:238628222-238628244 GGTGGAAGCATTCTTCCCTCTGG + Intergenic
924829694 1:247579935-247579957 GACCTAAGCATTCTTCCCTCTGG - Intergenic
1069619237 10:69826286-69826308 GAGCTAGCCATTCTTCCCTCTGG - Intronic
1069650632 10:70044787-70044809 AACCCATGCCTTCTTCCCTCTGG - Intergenic
1070285418 10:75079867-75079889 GAGCAAAGCATTCATCCCTTAGG - Intergenic
1071307970 10:84315873-84315895 GACCTCAGCATTCTTCCCCCAGG - Intergenic
1074951228 10:118338805-118338827 CACCCAAACATGCTTCCCTCTGG + Intronic
1077747247 11:4920202-4920224 AACCTAAGCCTTCTTCTCTTGGG + Intronic
1078690662 11:13577108-13577130 AACCTAAGTATTGTTCTCTCAGG - Intergenic
1079514368 11:21249324-21249346 AACCTATGCATTTTTCCCTCAGG + Intronic
1080185400 11:29478105-29478127 GACTTAAGGTTTCTTTCCTCTGG + Intergenic
1081718830 11:45271467-45271489 GTCCTAAGCATGCTCCCCTCTGG - Intronic
1084525906 11:69697880-69697902 GCCCTCAGCACTCTTCCCTGGGG - Intergenic
1085643512 11:78208174-78208196 GTCCTGAGCACTCTGCCCTCAGG - Intronic
1085645332 11:78218871-78218893 GCCCTCAGCTATCTTCCCTCCGG - Exonic
1088926317 11:114306804-114306826 GGCCTAAGCTTTCTTCTGTCAGG - Intronic
1089627899 11:119763019-119763041 GCCCAAAACATCCTTCCCTCAGG - Intergenic
1089944248 11:122451468-122451490 GAGCTAACCATTCTTTCCTTGGG + Intergenic
1091209800 11:133846336-133846358 GACCTAATCATTAGTCCCTCTGG + Intergenic
1098285075 12:68898448-68898470 GAGCTAAGCATCCTTCACTCTGG - Intronic
1099194705 12:79602118-79602140 GAACAAAGCATGCTTCCCTCAGG + Intronic
1106740011 13:32630662-32630684 GTCTTGAGTATTCTTCCCTCAGG + Intronic
1107642706 13:42460246-42460268 CTCCTAAGCCTTCTTCCCTAGGG + Intergenic
1107647407 13:42509281-42509303 CTCCTAAGCGTTCTTCCCTAGGG - Intergenic
1108671080 13:52689476-52689498 GAGCTAAGCATTCTTGTCTCTGG - Intronic
1111427102 13:88100708-88100730 GAACTAACCATTCTTCTCCCAGG - Intergenic
1113777445 13:112955934-112955956 GCCAGAGGCATTCTTCCCTCTGG + Intronic
1117779910 14:59221823-59221845 GCTGGAAGCATTCTTCCCTCTGG + Intronic
1122258455 14:100498216-100498238 GCACCAAGCAGTCTTCCCTCAGG - Intronic
1123153928 14:106206703-106206725 GACCTGAAAATTCTTTCCTCAGG + Intergenic
1124338705 15:28876249-28876271 GCCCTAAGCGTGCTTCCCACGGG - Intergenic
1124555543 15:30721746-30721768 GGCTTTAGCATTCTTTCCTCAGG + Intronic
1129951209 15:79593207-79593229 AAACTAAGCATTCTGGCCTCTGG - Intergenic
1130302295 15:82689203-82689225 GTCTGAAGCATTCTTTCCTCGGG + Exonic
1130944201 15:88538738-88538760 GACCTGAAAATTCTTTCCTCAGG - Intronic
1137127715 16:36826419-36826441 TTACTAAGAATTCTTCCCTCTGG - Intergenic
1137143702 16:37091724-37091746 TTACTAAGAATTCTTCCCTCTGG - Intergenic
1140463048 16:75156906-75156928 CACCCAGGCATTCTGCCCTCAGG + Intronic
1141020195 16:80488245-80488267 GACCTGAGTGTTTTTCCCTCTGG - Intergenic
1143135977 17:4712453-4712475 GACCTAACCATCTTTCCATCTGG - Intronic
1143136268 17:4714413-4714435 GACCTAACCATCTTTCCATCTGG - Intronic
1143377539 17:6475918-6475940 GACCTAATAATTCTTCCTCCAGG + Intronic
1144546486 17:16201034-16201056 AACTAAAGCATTCTTCCCTTTGG + Intronic
1144679298 17:17182384-17182406 GACCAGAGAATGCTTCCCTCGGG + Intronic
1148707477 17:49648437-49648459 GGCCTTTGCATTCTTCCCTCAGG + Intronic
1148714474 17:49706133-49706155 GGACTAAGAGTTCTTCCCTCAGG - Intronic
1150413271 17:64964880-64964902 AACCTAACCATTTTTCCCCCAGG - Intergenic
1150798545 17:68260335-68260357 AACCTAACCATTTTTCCCCCGGG + Intronic
1151492329 17:74440040-74440062 GACCCAGGTATTCTTCCTTCTGG + Exonic
1151810476 17:76437644-76437666 GACCCAAGCGATCCTCCCTCTGG + Intronic
1152543829 17:80990943-80990965 CACAGAAGCATTCTTCCCTGGGG - Intergenic
1155921522 18:31608110-31608132 GCCATAAGGACTCTTCCCTCAGG + Intergenic
1156705967 18:39882756-39882778 CTCCTAAGCATTCTTCCCACTGG + Intergenic
1159711554 18:71766007-71766029 GGCAGCAGCATTCTTCCCTCTGG - Intronic
1162726952 19:12695636-12695658 GTCCCAAGCTGTCTTCCCTCAGG + Intronic
1164038067 19:21471102-21471124 GTCCTAAACATGCTTTCCTCTGG + Intronic
1165709241 19:37998092-37998114 GCCCTAAGCATTCTTCTCTCTGG - Intronic
1167414540 19:49363152-49363174 GCCCTAAGCCATCTTCCCTCAGG - Intronic
925011809 2:491290-491312 GACCTGCTCATTCTTTCCTCGGG - Intergenic
925182386 2:1825803-1825825 CACCTTAGCATTCTGCCCACTGG - Intronic
925837512 2:7960253-7960275 GACCTTACCATTCTCCCTTCAGG + Intergenic
928686481 2:33755264-33755286 GATCTGCCCATTCTTCCCTCTGG + Intergenic
930122962 2:47774859-47774881 AACCTATGCATTCTTCCCATAGG - Intronic
932456703 2:71853973-71853995 AACCTGAGCATCCTGCCCTCTGG - Intergenic
933724836 2:85420844-85420866 GACCTAAGCAGTCGTTCCACGGG - Intronic
936610348 2:113996429-113996451 GATGGAAGCATTCTTCCTTCTGG + Intergenic
936623594 2:114124790-114124812 GACCCAAGCATCTTTCCATCAGG - Intergenic
937517612 2:122673100-122673122 GATCTAAACATTCTTTTCTCTGG + Intergenic
938706955 2:133940160-133940182 GACAGAAACATTCTTCCATCAGG - Intergenic
942481479 2:176392972-176392994 GACCTAAGCAGTCTTGTCCCAGG - Intergenic
947438044 2:230090303-230090325 GACATAAACATTCTTCTCTATGG + Intergenic
947832388 2:233150788-233150810 GAGCTAACCAGTCCTCCCTCGGG - Intronic
1169079688 20:2789402-2789424 GACCTAAGCAAGCTTCCTTTTGG - Intergenic
1171560649 20:26121991-26122013 AACTAAAGCATTCTTCCCTTTGG + Intergenic
1173809332 20:45946745-45946767 GTCCTGACCATTCTTCCTTCTGG - Intronic
1173857971 20:46263078-46263100 GGCCTCAGCATTCTGCCCACTGG + Intronic
1174167118 20:48592872-48592894 GCCCTAAGCACTGCTCCCTCTGG - Intergenic
1176650506 21:9542431-9542453 AACCTAAGCATTCTTCCCTTTGG - Intergenic
1180107816 21:45631346-45631368 GACCTTCAAATTCTTCCCTCTGG - Intergenic
1181034842 22:20164919-20164941 CACCTAACCATTCTCCCCTCCGG + Intergenic
1182566236 22:31202135-31202157 GACCTAGGCATGGTTCCCACAGG - Intronic
1182585854 22:31344043-31344065 GACCTCACCATTCTTCCCCCAGG - Intronic
1183433387 22:37779524-37779546 GAACCAAGCATTCTCCCTTCAGG + Intergenic
949378892 3:3422328-3422350 GAAGTAAACAGTCTTCCCTCTGG + Intergenic
951374533 3:21897173-21897195 GGTCTAAGCATTCTTATCTCAGG - Intronic
954846749 3:53566069-53566091 TACCTAATCATTCTTCACTTTGG - Intronic
955060595 3:55488861-55488883 GACCTCCTCATTCTTACCTCTGG + Intronic
955847610 3:63183085-63183107 TACTTAATCCTTCTTCCCTCAGG - Intergenic
957421663 3:79979401-79979423 GGTGGAAGCATTCTTCCCTCTGG + Intergenic
957606413 3:82405472-82405494 GCACTAAGCATAATTCCCTCAGG - Intergenic
960126038 3:113999259-113999281 GGTGAAAGCATTCTTCCCTCTGG - Intronic
963659741 3:148110281-148110303 GGCTTAAGCATTATTTCCTCAGG - Intergenic
964900967 3:161658219-161658241 GACCTCATCATCCTTACCTCAGG - Intergenic
965007225 3:163042244-163042266 AACCTGAACAGTCTTCCCTCAGG - Intergenic
966238803 3:177731778-177731800 GAGCTAAAAATTTTTCCCTCTGG + Intergenic
970419507 4:15892156-15892178 TAACTCAGGATTCTTCCCTCTGG - Intergenic
970886977 4:20997638-20997660 GCCCTTAGCATGCTTCTCTCTGG + Intronic
978366779 4:107990638-107990660 GACCTCAGCAATCTTCCATTAGG - Intronic
981003532 4:139852024-139852046 CACCTTAGCAATCTTCACTCTGG + Intronic
983970989 4:173874146-173874168 GGCCTCAGAATTTTTCCCTCTGG + Intergenic
984456753 4:179978585-179978607 GACCTAAGCATATTTTCCACAGG + Intergenic
988676156 5:33435103-33435125 GATAGAAGCATTCTTCCCTCAGG + Intergenic
988723853 5:33905691-33905713 GACCTAACCATTCTACTCTTTGG + Intergenic
990755392 5:59063685-59063707 GACCAAAGCATTCTAACCTTTGG + Intronic
992703919 5:79368680-79368702 GAGCCAAGCTCTCTTCCCTCTGG + Intergenic
994436803 5:99745817-99745839 GTCCTAAGTGTTCTGCCCTCAGG - Intergenic
996964536 5:129292308-129292330 CACCTATGCATTCCTCCATCCGG + Intergenic
998712609 5:144843884-144843906 GATCCATGCATTCTTCCCACTGG + Intergenic
1000688650 5:164286625-164286647 GACCAAAGCATTTTGTCCTCGGG + Intergenic
1001862676 5:175071494-175071516 GACCTAACGAATCTTCTCTCAGG + Intergenic
1003159673 6:3624425-3624447 GACTCTAGCATTCTCCCCTCAGG - Intergenic
1003510092 6:6772462-6772484 GCCCTATACCTTCTTCCCTCTGG + Intergenic
1006739057 6:36294369-36294391 GACCCACGCATTGTTCCCCCCGG + Exonic
1008142738 6:47850759-47850781 GTCTTAAGGATGCTTCCCTCAGG - Intergenic
1008193131 6:48484591-48484613 GACCTAAACATACTTCCCAAAGG - Intergenic
1011355965 6:86473648-86473670 GACCTGAAAATTCTTTCCTCAGG - Intergenic
1011738819 6:90338935-90338957 GCCAGAAGCATTCCTCCCTCTGG - Intergenic
1018434519 6:163748764-163748786 GACCTGAGCATGCTTCCCTGTGG + Intergenic
1018505464 6:164463125-164463147 GAAGAAAGCATTCTTTCCTCTGG + Intergenic
1023507184 7:40911996-40912018 GTCCTAAGCACTCTTCCCCAAGG + Intergenic
1026628917 7:72020896-72020918 GTTCTAAGCATTCTTCTTTCTGG - Intronic
1028048105 7:86149347-86149369 TACCCAAGCATGCTTTCCTCAGG - Intergenic
1032196729 7:129793757-129793779 GATCTGAGCATTTTTCACTCAGG + Intergenic
1036082871 8:5576890-5576912 GAACTAATGATTATTCCCTCTGG + Intergenic
1037818813 8:22125732-22125754 GACCTCTGCATTGTCCCCTCAGG - Exonic
1042194632 8:66221748-66221770 GACCCATGCATTCTTCCATAAGG + Intergenic
1042652398 8:71057818-71057840 GACCAGATCATTCTTTCCTCTGG - Intergenic
1044791997 8:95857479-95857501 GACCTATGTATTCTTCCTTCTGG - Intergenic
1045684345 8:104696140-104696162 GACCTGATCATTCTTTGCTCTGG + Intronic
1048476606 8:134748139-134748161 GACCCAAGCAATCATCCCCCAGG + Intergenic
1048856254 8:138689038-138689060 GACCTGATGATTCTTCCCTGGGG - Intronic
1050590388 9:7154310-7154332 CACCTAAGCATTCTCCCCAAGGG + Intergenic
1056449985 9:86707390-86707412 TACCAAAGCAGTCTTCCATCTGG - Intergenic
1056731077 9:89167170-89167192 GACATCAGAATTCTCCCCTCTGG + Intronic
1056936237 9:90916749-90916771 GGTGGAAGCATTCTTCCCTCTGG - Intergenic
1057713797 9:97471356-97471378 GACATAAGAATTCATCCCACTGG - Intronic
1060101642 9:120845872-120845894 GACCTACTCTGTCTTCCCTCAGG - Intergenic
1203628246 Un_KI270750v1:45985-46007 AACCTAAGCATTCTTCCCTTTGG - Intergenic
1186769889 X:12807195-12807217 GGACACAGCATTCTTCCCTCTGG - Intronic
1189032263 X:37462757-37462779 GATGGAAGCATTTTTCCCTCTGG + Intronic
1191871890 X:65753003-65753025 AACCTAAATATTCTTACCTCAGG + Intergenic