ID: 924832547

View in Genome Browser
Species Human (GRCh38)
Location 1:247613540-247613562
Sequence ACTCCTCATTCTCCTTTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924832547_924832551 30 Left 924832547 1:247613540-247613562 CCTGGGAAAGGAGAATGAGGAGT No data
Right 924832551 1:247613593-247613615 CAGAGCAAACACATTTCACCTGG No data
924832547_924832549 6 Left 924832547 1:247613540-247613562 CCTGGGAAAGGAGAATGAGGAGT No data
Right 924832549 1:247613569-247613591 GACAGTTTATAGTTCCAGGTAGG No data
924832547_924832548 2 Left 924832547 1:247613540-247613562 CCTGGGAAAGGAGAATGAGGAGT No data
Right 924832548 1:247613565-247613587 AAGTGACAGTTTATAGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924832547 Original CRISPR ACTCCTCATTCTCCTTTCCC AGG (reversed) Intergenic
No off target data available for this crispr