ID: 924832551

View in Genome Browser
Species Human (GRCh38)
Location 1:247613593-247613615
Sequence CAGAGCAAACACATTTCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924832547_924832551 30 Left 924832547 1:247613540-247613562 CCTGGGAAAGGAGAATGAGGAGT No data
Right 924832551 1:247613593-247613615 CAGAGCAAACACATTTCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924832551 Original CRISPR CAGAGCAAACACATTTCACC TGG Intergenic
No off target data available for this crispr