ID: 924837816

View in Genome Browser
Species Human (GRCh38)
Location 1:247672152-247672174
Sequence CAGAATAGGGAGATGCAGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 342}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924837816_924837823 6 Left 924837816 1:247672152-247672174 CCTGCCTGCATCTCCCTATTCTG 0: 1
1: 0
2: 2
3: 35
4: 342
Right 924837823 1:247672181-247672203 GTACACCATCGGGTTTAATGTGG 0: 1
1: 0
2: 0
3: 2
4: 26
924837816_924837821 -5 Left 924837816 1:247672152-247672174 CCTGCCTGCATCTCCCTATTCTG 0: 1
1: 0
2: 2
3: 35
4: 342
Right 924837821 1:247672170-247672192 TTCTGGAAGCTGTACACCATCGG 0: 1
1: 0
2: 2
3: 10
4: 198
924837816_924837824 7 Left 924837816 1:247672152-247672174 CCTGCCTGCATCTCCCTATTCTG 0: 1
1: 0
2: 2
3: 35
4: 342
Right 924837824 1:247672182-247672204 TACACCATCGGGTTTAATGTGGG 0: 1
1: 0
2: 0
3: 2
4: 41
924837816_924837822 -4 Left 924837816 1:247672152-247672174 CCTGCCTGCATCTCCCTATTCTG 0: 1
1: 0
2: 2
3: 35
4: 342
Right 924837822 1:247672171-247672193 TCTGGAAGCTGTACACCATCGGG 0: 1
1: 0
2: 1
3: 11
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924837816 Original CRISPR CAGAATAGGGAGATGCAGGC AGG (reversed) Exonic
900408821 1:2503857-2503879 CAGAAGAGAGAGAGGGAGGCAGG - Intronic
900491434 1:2951217-2951239 GAGAATAGGCAGGGGCAGGCAGG - Intergenic
900933354 1:5750527-5750549 CAGAAGATGGAGTTCCAGGCAGG - Intergenic
901045238 1:6392394-6392416 CAGAATCGGAAGCAGCAGGCTGG - Intronic
903352622 1:22727168-22727190 CAGAGCAGGGAGAGGCAAGCTGG + Intronic
903442057 1:23395527-23395549 TAGAAGAGGGACATTCAGGCTGG + Intronic
904109332 1:28113112-28113134 CAGAATAGAGAACTGGAGGCGGG + Intergenic
905028817 1:34868172-34868194 CAGAAGAGGGAGATTCAGCCAGG - Intronic
905341979 1:37284677-37284699 CAGACTAAGAAGATGCAGGATGG - Intergenic
905349223 1:37333107-37333129 CAGAGGAGTGAGCTGCAGGCAGG - Intergenic
907110634 1:51923347-51923369 CAGGAGAGGGAGAGGCTGGCAGG + Intronic
907981066 1:59481453-59481475 AAGAATAGGGACATGCATTCAGG - Intronic
908089096 1:60667859-60667881 CAGAGTGGGGAGAGGCAGGGGGG + Intergenic
909892451 1:81024625-81024647 ATGAATAGGGAGATACAGACCGG - Intergenic
910584923 1:88869033-88869055 CAGAATACACAGATACAGGCCGG - Intronic
911401367 1:97379251-97379273 GACAATGGGGAGAGGCAGGCAGG + Intronic
911814759 1:102333144-102333166 CAGGATAGGAAGATGCAGGGTGG - Intergenic
912519386 1:110234775-110234797 AAGAATAAGGAGAGGCAAGCAGG - Intronic
913159543 1:116132770-116132792 CAGAAGAGGCAGAAGCAGGGAGG + Intronic
913200338 1:116490990-116491012 GAGAGTAGAGAGATGCAGACAGG - Intergenic
915971919 1:160361080-160361102 CACAATAGGCAGAGGCAGGCTGG - Intergenic
916456654 1:164977853-164977875 CAGGATTTGGCGATGCAGGCAGG - Intergenic
920145904 1:203861048-203861070 CAGAAAATGGAGATACAGGCCGG + Intergenic
920387099 1:205576907-205576929 CAGTCCAGGGAGATGCAGGGAGG + Intronic
922561032 1:226569770-226569792 CAGAAGAGGGTCACGCAGGCAGG - Intronic
923245841 1:232131193-232131215 CAAAAAAAGGGGATGCAGGCAGG - Intergenic
924457120 1:244227846-244227868 AAGAATAGGGAGACTCAGGCTGG - Intergenic
924837816 1:247672152-247672174 CAGAATAGGGAGATGCAGGCAGG - Exonic
1063303208 10:4872592-4872614 CAGAGAGTGGAGATGCAGGCAGG - Intergenic
1064404774 10:15051984-15052006 CAGAATATGTGGCTGCAGGCTGG + Intronic
1064490562 10:15851377-15851399 GTGAAGAGGGAGATGCAGGCAGG - Intronic
1064609626 10:17084841-17084863 CAGAATAGCAAGATGTAGCCAGG + Intronic
1069226045 10:65945642-65945664 GATAAAAGGGAGATGCAGGATGG + Intronic
1069510368 10:69037658-69037680 CAGAGCCCGGAGATGCAGGCAGG + Intergenic
1070312579 10:75284353-75284375 CAGAAGAGGGAGCAGCAGGCGGG + Intergenic
1071415308 10:85435926-85435948 CCAAAGAGGGAGATGCAGGCTGG - Intergenic
1071920814 10:90348036-90348058 CAGAATAGCAGGAGGCAGGCAGG + Intergenic
1073681479 10:105708755-105708777 TAGAATTGCAAGATGCAGGCTGG - Intergenic
1076000752 10:126911293-126911315 CAGCACAGGGAGCTGCACGCTGG - Intronic
1076331732 10:129675309-129675331 GAGGTTAGGCAGATGCAGGCAGG + Intronic
1076727622 10:132420855-132420877 CAGAAAAGGGAAGTGCTGGCTGG - Intergenic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083652025 11:64209420-64209442 CAGAATAGGGAGACCCAGTAAGG + Intronic
1083871260 11:65489841-65489863 CAGAGTAGGGAAAGGAAGGCCGG - Intergenic
1083904326 11:65660277-65660299 CAGAGTAGGAAGGAGCAGGCTGG - Intronic
1084893212 11:72247182-72247204 AAGAACAGGGGGAGGCAGGCTGG - Intergenic
1085169351 11:74435260-74435282 CAGAACAGAGACATGCAGACAGG - Intergenic
1085320515 11:75571242-75571264 CAGAATAATCAGATGCAGGGGGG - Intronic
1087700530 11:101431718-101431740 AAGAAGAGGGAAATTCAGGCTGG - Intergenic
1088881170 11:113974837-113974859 CAGGATAGGGTGAGTCAGGCAGG - Intergenic
1089384045 11:118056447-118056469 CAAAATGGGGACATGCAGGAAGG + Intergenic
1089938647 11:122392694-122392716 AAGAAGTGGGAGAGGCAGGCGGG - Intergenic
1090073285 11:123562234-123562256 CAGAAAAGAGAGAAGCAGGGAGG - Intronic
1090803157 11:130187310-130187332 CAGAATACGGAGGGGCAGGTGGG - Intronic
1091229878 11:133981377-133981399 CAGGAGAGGGAGAGGCAGGAAGG + Intergenic
1091421120 12:341603-341625 CATAATAGAGAAATGGAGGCTGG + Intronic
1091513506 12:1153984-1154006 CAGAGCAGGGGGAGGCAGGCAGG - Intronic
1091705433 12:2690243-2690265 CAGAAAGGAGAGAGGCAGGCTGG + Intronic
1091938146 12:4449962-4449984 GAGAACAGGGAGATCCACGCAGG - Intergenic
1092233836 12:6793209-6793231 CAGAACAGGGAGCTGGAGGCAGG + Intronic
1092764713 12:11842100-11842122 AAGAAGAAGGAGATGTAGGCTGG + Intronic
1093459266 12:19393727-19393749 CAGAATGTAGAGATCCAGGCTGG + Intergenic
1094312581 12:29100878-29100900 CAAATTAGGGTGATCCAGGCAGG - Intergenic
1094571748 12:31647207-31647229 GAGGATAGGGTGAGGCAGGCTGG - Intronic
1096555994 12:52404194-52404216 GAGGATAGAGAGAGGCAGGCAGG - Intronic
1097804654 12:63952145-63952167 CAGAATAGTGAGGTGCAGAGTGG - Intronic
1098247183 12:68532131-68532153 CAGATTGGGGAGAGGGAGGCAGG + Intergenic
1098711767 12:73771774-73771796 CAGAATAGGGAGTTGCTGATTGG + Intergenic
1098964004 12:76766721-76766743 CAGAAAATGGAGATCCTGGCTGG + Intronic
1102069883 12:110009671-110009693 CAGATGAGAGAGATGCAGGAAGG + Intronic
1102534101 12:113568161-113568183 CAGCCTAGGGGCATGCAGGCTGG + Intergenic
1102688563 12:114742695-114742717 CAGAAAAGAGAGATGGAGGCAGG + Intergenic
1103003994 12:117407444-117407466 CAGAGGAGGGAGAGGCAGGTGGG - Intronic
1103555920 12:121766433-121766455 CAGAACAGGGAGCTGGAGCCGGG - Intronic
1104062198 12:125277978-125278000 CACAACTGGGAGAAGCAGGCTGG - Intronic
1104569328 12:129911150-129911172 AAGAATTGTTAGATGCAGGCTGG - Intergenic
1104845748 12:131845959-131845981 CCGACCAGGGAGAGGCAGGCCGG - Intronic
1106049442 13:26176634-26176656 AAGAAGAGGAAAATGCAGGCTGG + Intronic
1106949731 13:34870017-34870039 CAGAGTAAGAAGATACAGGCAGG + Intergenic
1107064289 13:36195904-36195926 CAAAATAGGCATATGCAGGAGGG + Intronic
1108834401 13:54523293-54523315 GAGAAAAGGGAGAGGAAGGCAGG - Intergenic
1112344709 13:98579412-98579434 CAAAACAGGGAGATTCCGGCAGG + Intergenic
1112700192 13:101999066-101999088 AAGACTAGGGAGAGGCAGACTGG + Intronic
1113754322 13:112799405-112799427 CAGCAAAGGGAGATGGAGGTGGG + Intronic
1114570907 14:23667610-23667632 CAGCATAGGGAAAACCAGGCTGG - Intergenic
1114895870 14:26990618-26990640 TAGAATAGGGAGAAGAAGGAAGG + Intergenic
1115154540 14:30323052-30323074 CAGAGGAAGGAGAGGCAGGCAGG - Intergenic
1117388365 14:55239159-55239181 CATAAAAAGGAGATCCAGGCCGG - Intergenic
1118486753 14:66221684-66221706 GAGAAAAGGGAGATGCAGGAAGG - Intergenic
1118836781 14:69483871-69483893 CAGGCCAGGGAGATGCCGGCCGG - Intergenic
1119420629 14:74505908-74505930 CAGCATAGGGAGGTGCAGGCGGG - Intronic
1119535937 14:75402287-75402309 CAGAACCCGGAGGTGCAGGCTGG + Intergenic
1119678184 14:76572082-76572104 CTTAATAAGAAGATGCAGGCTGG - Intergenic
1119956128 14:78800233-78800255 CAGAACTGGGAGTTGCATGCAGG - Intronic
1120015629 14:79470216-79470238 CACAAGGGGGAGATGAAGGCAGG + Intronic
1120555697 14:85928029-85928051 CACAAAAGAAAGATGCAGGCTGG + Intergenic
1121475162 14:94193596-94193618 AATAATAGGGAGGTTCAGGCTGG + Intronic
1121505321 14:94472817-94472839 GAGAAGAGAGAGATTCAGGCTGG + Intronic
1122363406 14:101180758-101180780 CAGGGAAGGGAGGTGCAGGCAGG - Intergenic
1123801531 15:23826149-23826171 CAAAATATGGAGAGACAGGCAGG - Intergenic
1125448861 15:39787018-39787040 CAGGATTGGGAGATGCTGGAGGG - Intergenic
1125617074 15:41024362-41024384 CAGAATAGGGGGAGGCTGTCTGG - Intronic
1126046671 15:44648215-44648237 CAGAATAGTAGGAAGCAGGCTGG + Intronic
1127242015 15:57126655-57126677 CAAGATTGGTAGATGCAGGCTGG - Intronic
1127872116 15:63082433-63082455 CAGCACAGGGAGATCGAGGCAGG + Intergenic
1128230429 15:66030981-66031003 CAGAATGGGCAAGTGCAGGCAGG - Intronic
1130556753 15:84928183-84928205 CAGAATGGGCAGAGGCAGCCAGG + Intronic
1131423081 15:92323616-92323638 CAGAATGGGGAGATCCAGGGTGG - Intergenic
1132883356 16:2171932-2171954 CAGAGTGCGGAGAGGCAGGCAGG - Intronic
1133483095 16:6190983-6191005 CAGAATCGGGAGAGGCTGGGAGG - Intronic
1134316583 16:13124373-13124395 CAGGGTAGGGAGATGGAGGAGGG + Intronic
1134638170 16:15808467-15808489 TAGAGTGGGGAGATGAAGGCTGG - Intronic
1134676880 16:16096971-16096993 AAGAAGAGGGACATGAAGGCTGG - Intronic
1135516292 16:23138449-23138471 CAGACTAGGGACATGGAGGATGG - Intronic
1135520108 16:23169968-23169990 CAGACAATGGAAATGCAGGCTGG - Intergenic
1135588391 16:23688682-23688704 CAGAAGATGGGGATGCAGGCAGG - Exonic
1136153203 16:28365496-28365518 CAGAATGGGGGGATGGAGGGTGG + Intergenic
1136209883 16:28749777-28749799 CAGAATGGGGGGATGGAGGGTGG - Intergenic
1137910232 16:52370573-52370595 AAGAATAAGGAAATGCAGACAGG - Intergenic
1139503358 16:67386455-67386477 AAGAAGAGGCAGAGGCAGGCCGG + Intergenic
1139956658 16:70696600-70696622 CACACTGGGGAGAAGCAGGCTGG - Intronic
1141267651 16:82511476-82511498 CACAAGAGGAAGATGTAGGCTGG - Intergenic
1141359314 16:83380681-83380703 TAGAATATGGAGGTGAAGGCTGG - Intronic
1141489884 16:84365594-84365616 TATAATAGGGAAATGTAGGCCGG - Intergenic
1142607385 17:1089661-1089683 AAGAAGAAGGAAATGCAGGCCGG + Intronic
1144013848 17:11175070-11175092 CAGACTATGGAGAGGCAAGCAGG + Intergenic
1144452063 17:15389370-15389392 CAGAAGTGGGTGATTCAGGCTGG - Intergenic
1144453881 17:15403422-15403444 GAGAATAGGGAGAGGGTGGCTGG - Intergenic
1144796419 17:17894406-17894428 CAGACAAGGGAGGAGCAGGCAGG - Intronic
1146138249 17:30342060-30342082 CAGAGCAGGGAGATCCAAGCTGG - Intergenic
1146929193 17:36765859-36765881 CAGACTAGCGAGATCCAGCCAGG - Intergenic
1147588974 17:41669079-41669101 CAAAATAGGGAGGTCAAGGCTGG + Intergenic
1147915479 17:43882944-43882966 CAGCATCGGGAGGTACAGGCTGG + Exonic
1148643345 17:49204588-49204610 CAGAATGGTGAGATGGAGTCAGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149546680 17:57509047-57509069 CAGACTGGGAAGATGGAGGCAGG - Intronic
1149867124 17:60157206-60157228 CAGGAGAGGGGGAGGCAGGCAGG + Intronic
1151532293 17:74714454-74714476 GAGAGAAGGGAGATGCAAGCAGG + Intronic
1151848984 17:76678550-76678572 CAGAAGAGTGAGATGCAGCCAGG - Intronic
1151869046 17:76824187-76824209 CTGAAGAGGGAAATGCAGGATGG - Intergenic
1153130782 18:1853631-1853653 CAGATTAAGGAAATGCAGGAGGG - Intergenic
1153458111 18:5300852-5300874 CAGAAAAGGGAGTTCCAGGAAGG - Intergenic
1153977048 18:10278555-10278577 CAGCTTGGGGAGAGGCAGGCAGG - Intergenic
1154332416 18:13440892-13440914 CAGAATAGGGAGAATCATCCAGG - Intronic
1155494090 18:26425921-26425943 GAGAAATGTGAGATGCAGGCAGG + Intergenic
1156183994 18:34640263-34640285 CAGAGGAGGGACAGGCAGGCAGG - Intronic
1157110341 18:44814681-44814703 GAGAAGAGATAGATGCAGGCTGG + Intronic
1157128482 18:44980601-44980623 CAGAGGAGGGAGAGGCAGGGAGG + Intronic
1158941922 18:62412496-62412518 TAGAAGAGGGAGGTGGAGGCTGG - Intergenic
1159973205 18:74678430-74678452 CAGAAAATGGGGTTGCAGGCAGG - Intronic
1161066770 19:2242511-2242533 CAGAAAAGGGATGTGCAGGTGGG - Intronic
1161659664 19:5538154-5538176 CAGGACAGGGAGGTGGAGGCAGG + Intergenic
1161740488 19:6018264-6018286 CATAAAAAGGAGATGAAGGCCGG - Intronic
1162015200 19:7841759-7841781 CAGCATAGGGAGATGGAGATGGG + Intronic
1163276369 19:16286762-16286784 CAGGATGGAGAGAGGCAGGCAGG - Intergenic
1163399795 19:17085337-17085359 CAGCATTGGGAGATCCTGGCAGG + Intronic
1163460784 19:17436272-17436294 CAGAATGAGGAGGTGAAGGCTGG + Exonic
1163786758 19:19278819-19278841 GAGAAGAGGGAGAAGCAGGAAGG + Intronic
1164645387 19:29855411-29855433 AAGATAAGGGAGATGCATGCTGG + Intergenic
1166416611 19:42599881-42599903 CAGAAGAGGGAGGTGCAGGGCGG + Intronic
1166422826 19:42652050-42652072 CAGAAGAGGGAGGTACAGGGTGG - Intronic
1166436182 19:42767751-42767773 CAGAAGAGGGAGCAGCAGGGTGG + Intronic
1166455925 19:42939240-42939262 CAGAAGAGGGAGCAGCAGGGTGG + Intronic
1166471858 19:43084719-43084741 CAGAAGAGGGAGCAGCAGGGTGG + Intronic
1166482991 19:43188535-43188557 CAGAAGAGGGAGCAGCAGGATGG + Intronic
1166485473 19:43207667-43207689 CAGAAGAGGGAGCAGCAGGGTGG + Intergenic
1166492625 19:43271573-43271595 CAGAAGAGGGAGCAGCAGGGTGG + Intergenic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167172909 19:47845346-47845368 CAGAATAGGCAAATCCAGCCAGG + Intergenic
1168115540 19:54219926-54219948 CAGGACAGGGAGGTGAAGGCTGG + Intronic
925022816 2:585246-585268 AAGAGTAGGAAGATGCACGCAGG + Intergenic
925203561 2:1988263-1988285 CAGGAATGGGAGGTGCAGGCGGG - Intronic
925668646 2:6289027-6289049 CAGAGAAAGGAGATGCAGGAAGG - Intergenic
925980778 2:9175455-9175477 CAGAAAATGGATATGAAGGCAGG - Intergenic
927280974 2:21306108-21306130 GAAAAGAGAGAGATGCAGGCTGG + Intergenic
927374581 2:22398992-22399014 CAGAAGAGGTAGATGTAGACAGG - Intergenic
928731752 2:34239934-34239956 CAAAAGAGGAAGAAGCAGGCAGG + Intergenic
929533206 2:42764905-42764927 CGGAATAGGGAGTGGGAGGCTGG + Intergenic
929534071 2:42769753-42769775 CACCACAGGGAGCTGCAGGCAGG - Exonic
932330094 2:70893921-70893943 AAGAAGAGGGAGATGGAGGAAGG + Intergenic
932397889 2:71460653-71460675 CAGACTAGGAAGTTGGAGGCTGG + Intronic
932408594 2:71530805-71530827 GAGAAAAGGGACATGCAAGCAGG - Intronic
932865484 2:75336960-75336982 CTGAGGAGGGAGATGGAGGCTGG - Intergenic
933703911 2:85275670-85275692 CAGAATTGGGAGGTGAAGGCGGG + Intronic
933947506 2:87299420-87299442 CTGTATAGGGAGCTCCAGGCTGG - Intergenic
934579394 2:95426524-95426546 AAGGAAAGGGAGATGCAGGACGG - Intergenic
934600049 2:95650200-95650222 AAGGAAAGGGAGATGCAGGACGG + Intergenic
936327980 2:111522087-111522109 CAGAGCAGGGAGGAGCAGGCTGG + Intergenic
936332691 2:111562151-111562173 CTGTATAGGGAGCTCCAGGCTGG + Intergenic
937383182 2:121400429-121400451 ACGCATAGGGAGATGCCGGCAGG + Intronic
937727426 2:125183900-125183922 CAAAATAGGGAGAAGAAGCCAGG - Intergenic
939423448 2:142003640-142003662 CAGAGTAATGAAATGCAGGCAGG + Intronic
940659916 2:156533439-156533461 CTGAATGGTGAGACGCAGGCTGG - Intronic
942622657 2:177864207-177864229 GAAAATAGGGAGATGTAGGTCGG + Intronic
944656467 2:201880962-201880984 CAGAAGAGAGAGAAGCAGCCAGG + Intronic
944803471 2:203258858-203258880 CAGAATAGGAAGATTCTGACTGG - Intronic
946321362 2:218956264-218956286 CAGATTAGGGAGAAGCAGACAGG + Intergenic
946489107 2:220130663-220130685 CACAATGGTGAGATGCAGCCTGG + Intergenic
1169099383 20:2932826-2932848 TAGATTAGGGAGTTGTAGGCTGG + Intronic
1170841613 20:19928765-19928787 CACAAGAGGGAGAGGAAGGCAGG - Intronic
1172589246 20:36105891-36105913 CAGAATAGGGAAAAGGTGGCAGG - Intronic
1172995777 20:39069509-39069531 CAAAATAGGCAGATGAAGTCAGG + Intergenic
1173117485 20:40259600-40259622 CAAAAGAGAGAGATGAAGGCCGG + Intergenic
1173562162 20:44013723-44013745 TAGAATAAGCAGCTGCAGGCAGG - Intronic
1173978592 20:47205967-47205989 AAGAAGAGGGAGATGCAGTGAGG - Intergenic
1174184998 20:48700065-48700087 CTGAGTAGGTAGATGGAGGCAGG - Intronic
1174292622 20:49519735-49519757 CAGAAGAGGGAGATGGCGGGAGG - Intronic
1175361658 20:58415943-58415965 CAGAGTAGGGAGAGGAAGGTTGG + Intronic
1177198325 21:17926567-17926589 CAGCATGGAGAGATGCAAGCAGG + Intronic
1178885159 21:36479324-36479346 CAGGAAAGGAAGCTGCAGGCTGG - Intronic
1179200844 21:39219127-39219149 AAAAATAAGGAGAAGCAGGCAGG + Intronic
1179525616 21:41974160-41974182 CAGTGTAGGGAGATGGAGCCAGG + Intergenic
1180834383 22:18922613-18922635 CAGAGAGGGGAGATGCTGGCAGG - Intronic
1181065428 22:20303490-20303512 CAGAGAGGGGAGATGCTGGCAGG + Intergenic
1181821950 22:25483332-25483354 CAGGAGAGGGAGCAGCAGGCTGG - Intergenic
1183173429 22:36204585-36204607 GAGAATAAGGAGATGGAGGGAGG + Intronic
1183257335 22:36770968-36770990 AAGAAAAAGGAGAAGCAGGCGGG - Intronic
1184455399 22:44607188-44607210 CAGAACAGTCAGGTGCAGGCAGG + Intergenic
1184766546 22:46575518-46575540 CAGAGTAGGGAGCGGTAGGCAGG + Intergenic
1184980968 22:48096074-48096096 CGGGATGGGGAGATGCAGGCGGG + Intergenic
1184980975 22:48096093-48096115 CGGGATGGGGAGGTGCAGGCGGG + Intergenic
1184980981 22:48096112-48096134 CGGGATGGGGAGATGCAGGCGGG + Intergenic
1184981029 22:48096245-48096267 CAGGGTGGGGAGGTGCAGGCGGG + Intergenic
1185261349 22:49865956-49865978 CAGCATCGGGAGGTGGAGGCGGG - Intronic
1185334674 22:50266188-50266210 CAGGAGAGGGAGCTGCTGGCTGG + Intronic
1185371129 22:50461433-50461455 GAGAAAAGGGAGAGGGAGGCAGG + Intronic
1203284472 22_KI270734v1_random:147912-147934 CAGAGAGGGGAGATGCTGGCAGG - Intergenic
949253388 3:2015265-2015287 AAGAAGGGAGAGATGCAGGCTGG + Intergenic
949445174 3:4127515-4127537 CACAAGAGAAAGATGCAGGCTGG - Intronic
952224176 3:31357240-31357262 CACAAGAGGGTGATGAAGGCTGG + Intergenic
952991269 3:38832998-38833020 CAGAAGCAGGAGCTGCAGGCAGG + Intergenic
954115389 3:48464371-48464393 CAGAATAGGGGGCTGGAGGCAGG + Intronic
954216318 3:49126388-49126410 CAGAGTAGGGAGTCTCAGGCTGG + Exonic
954364012 3:50136862-50136884 CAGCCTAGGGACATGCAGCCGGG + Intergenic
954514813 3:51164324-51164346 CAAAATAAAGAGATTCAGGCCGG + Intronic
954871119 3:53768163-53768185 CAGAATAGGGAGAGGCCCGCAGG + Intronic
955424682 3:58776036-58776058 CAGAAAAGGGAGAGGAAGGCTGG - Intronic
955562919 3:60212297-60212319 CAACATAGGGACATGCAGCCAGG + Intronic
956004206 3:64761692-64761714 CAGAATAGGAAGATGGTGGTGGG + Intergenic
958487310 3:94729239-94729261 CAACATAGGGAGACCCAGGCTGG + Intergenic
959615524 3:108342935-108342957 CATAATACAGAGATGCAGGCAGG - Intronic
961223616 3:125219534-125219556 GTGACTCGGGAGATGCAGGCCGG + Intergenic
961553404 3:127681523-127681545 CTGAACAGGGAAATGCAGCCAGG + Intergenic
961680920 3:128599519-128599541 CAGAATAAATAGATACAGGCCGG + Intergenic
961917598 3:130393294-130393316 CAGAAAAGTGAGACGTAGGCAGG - Intronic
962880948 3:139575867-139575889 CAAAACAGGGATCTGCAGGCTGG - Intronic
963736557 3:149023734-149023756 CAGAATAGGGAGGCCAAGGCAGG + Intronic
964777825 3:160298042-160298064 GTGAATAGGGAGAAGAAGGCAGG + Intronic
965287405 3:166834227-166834249 CAGAACTGGGAGATCAAGGCGGG + Intergenic
966087048 3:176080510-176080532 AAGAGAAGGGAGATGCAAGCAGG - Intergenic
967223829 3:187272674-187272696 TAGAATAGGCAGTTGTAGGCGGG - Intronic
967322979 3:188212516-188212538 CCAAATATGGAGAAGCAGGCTGG - Intronic
967664799 3:192158294-192158316 GAGAAAAGGGAAAAGCAGGCAGG - Intronic
969874116 4:10123486-10123508 CAGCATTGGGAGGTGCTGGCAGG - Intergenic
970386608 4:15562988-15563010 CAGACAAGGAAGATGCAGGGAGG + Intronic
972339887 4:38142961-38142983 CTGGATATGGAGAGGCAGGCAGG - Intergenic
975488114 4:74957687-74957709 TAGAGTAGAGAGCTGCAGGCAGG + Intronic
975644067 4:76528848-76528870 AAGAATAGGGAGAGGAAGACCGG - Intronic
978833337 4:113116322-113116344 CAAAAGAGGGAGAGGAAGGCAGG - Intronic
979857588 4:125652339-125652361 AGGAATAGGGAGATGGAGACAGG - Intergenic
979996919 4:127442427-127442449 AAGAATAGGGAGAACCGGGCAGG + Intergenic
980840594 4:138256154-138256176 CAGAATGGGGAAGTGCATGCTGG - Intergenic
980985303 4:139689362-139689384 CACAATAGGGAGGTGGCGGCTGG - Intronic
982076897 4:151746800-151746822 GGGAACAGGGAGATGGAGGCAGG + Intronic
985391828 4:189498215-189498237 CAGGTGAGGGAGGTGCAGGCAGG + Intergenic
985429774 4:189868018-189868040 GAGAAGAAGCAGATGCAGGCAGG - Intergenic
985820583 5:2157466-2157488 CAGGATTCGGAGCTGCAGGCAGG - Intergenic
985947765 5:3200257-3200279 CAGCATCTGGAGGTGCAGGCTGG - Intergenic
986746522 5:10749812-10749834 CAGAATTTGGAAATGCTGGCTGG + Intronic
987705220 5:21454886-21454908 CAGTGAAGGGAGATGCAGTCAGG + Intergenic
988300706 5:29422311-29422333 CAGTGAAGGGAGATGCAGTCAGG - Intergenic
988316307 5:29634079-29634101 CAGAATGTGGAGAGTCAGGCAGG - Intergenic
990184564 5:53199750-53199772 AAGAATATGGTGATGCATGCAGG - Intergenic
991692536 5:69238856-69238878 CAGAATAACAAGTTGCAGGCTGG - Intronic
992234222 5:74692669-74692691 CAGAATAGTTAGCTGCAGGTAGG - Intronic
992787914 5:80187367-80187389 CAGAAAAGGGAAAGGCAGACTGG - Intronic
994214114 5:97117860-97117882 CAGAGTAGTGAGATGCGGGGTGG - Intronic
995001949 5:107143878-107143900 CAGATTGGGGAGCAGCAGGCAGG + Intergenic
995002079 5:107145408-107145430 CAGATTGGGGAGCAGCAGGCAGG + Intergenic
995550193 5:113273886-113273908 CAGACTTGGGAGATGAAGGAAGG - Intronic
997621039 5:135295559-135295581 CAGAATGAGGACATGCATGCAGG - Intronic
998852430 5:146364002-146364024 CAGAAGAAGGAGATGAAGGGTGG + Intergenic
999238924 5:150116215-150116237 CAGAGGAGGGAGATGCTGGTGGG - Intronic
999686903 5:154111360-154111382 CAGAATTAGGAAATTCAGGCAGG + Intronic
1000181667 5:158817487-158817509 CACAATAGGATGATGCAGCCTGG + Intronic
1000906892 5:166975171-166975193 CAGAACAGCGAGATGAATGCTGG + Intergenic
1000993713 5:167937677-167937699 CAGAATTGAGAAAAGCAGGCAGG - Intronic
1001398749 5:171434344-171434366 CAGGATCGGGAGATACATGCAGG + Intronic
1001775435 5:174325998-174326020 CAGAACAGGGATATGCACCCAGG - Intergenic
1002201342 5:177530420-177530442 CAGGAGAGGGAGATGGAGGCAGG - Intronic
1002644260 5:180645494-180645516 AGGAAGAGGGAAATGCAGGCAGG + Intronic
1003058585 6:2844130-2844152 AAGAATTTGGAGATGCATGCTGG - Intergenic
1003378924 6:5604557-5604579 CAGAACTGTGAGCTGCAGGCAGG + Intronic
1004450503 6:15740976-15740998 AAGAAGTGTGAGATGCAGGCGGG + Intergenic
1006638760 6:35478149-35478171 AAAAATAGAGGGATGCAGGCTGG - Intronic
1009023083 6:57966020-57966042 CAGTGAAGGGAGATGCAGTCAGG - Intergenic
1010885099 6:81227085-81227107 CAGAGTAGGATGATTCAGGCTGG + Intergenic
1011216941 6:85015111-85015133 CAGAATAGGGAGACGAAAGGAGG - Intergenic
1011719900 6:90144523-90144545 CAAAAAAGGGAGATCCTGGCTGG + Intronic
1012928357 6:105290692-105290714 CAGATAAGAGAGTTGCAGGCTGG - Intronic
1013253474 6:108359074-108359096 CAAAATAGACAGATACAGGCTGG - Intronic
1013437570 6:110126831-110126853 CAGATTAGGGAGAAGGAGACAGG - Intronic
1013564356 6:111342370-111342392 AAGAATAGGAAGATCCAGGCCGG + Intronic
1013859840 6:114622622-114622644 CTGCATAGGGACATGCATGCTGG + Intergenic
1014871455 6:126601625-126601647 AAGTATTTGGAGATGCAGGCAGG - Intergenic
1015382295 6:132583339-132583361 CAGAATAGGCAGAGGCAGCATGG + Intergenic
1015754955 6:136597596-136597618 CAGAATCTGGAGGTGCAAGCTGG - Intronic
1016305293 6:142677823-142677845 CATAAAAAGGAGAGGCAGGCAGG - Intergenic
1016734705 6:147464707-147464729 AAGAATAGGGAGAGGAAGGAAGG - Intergenic
1017581802 6:155873014-155873036 CAGAACAGAGAGGGGCAGGCTGG + Intergenic
1017999470 6:159566125-159566147 GAAAGTAGGGAGAGGCAGGCAGG + Intergenic
1018346878 6:162908857-162908879 CAGCACAGGGAGATGGAAGCTGG + Intronic
1018889524 6:167973527-167973549 CAGAACAGGAGGGTGCAGGCAGG + Intergenic
1019356768 7:584218-584240 CAGCAAAGGGAGAAGCAGACAGG + Intronic
1020734848 7:11935041-11935063 CAGAGTAGGAAGAAGCAGGCAGG + Intergenic
1021602736 7:22380379-22380401 CAGAAGATGGAGATTCAGGTGGG + Intergenic
1022286769 7:28961085-28961107 AAGAATCTGGAGATGCAGGCTGG + Intergenic
1023032041 7:36098352-36098374 AGGAATAGGAAGATGAAGGCAGG + Intergenic
1023116566 7:36868642-36868664 CAGAATAAGGAGAAGCGGGCAGG - Intronic
1023727902 7:43163444-43163466 AAGACTGGGGAGATGGAGGCAGG + Intronic
1024015684 7:45312141-45312163 CAGCAGTGGCAGATGCAGGCAGG + Intergenic
1024217195 7:47257376-47257398 CGGGATAGGGAGGTGCTGGCAGG + Intergenic
1024431381 7:49291981-49292003 CACGAGAGGGAGATGAAGGCTGG + Intergenic
1026494967 7:70894177-70894199 CAGAACAGGCAGATTCTGGCAGG - Intergenic
1026890721 7:73980342-73980364 CAGAACAGGGAGATGAAAGCTGG + Intergenic
1027766658 7:82352578-82352600 TAAAAGATGGAGATGCAGGCTGG + Intronic
1028408408 7:90501194-90501216 TAGAAAAAGGAGATACAGGCAGG + Intronic
1032017316 7:128388429-128388451 CAGAAGAGGGAGAAGCAGAAAGG + Intergenic
1034065632 7:148133947-148133969 CAGCATAGGCAAATGCAGGTGGG + Intronic
1034205235 7:149308965-149308987 CAGAATAGGGAGAAGCCACCTGG + Intergenic
1035022446 7:155807548-155807570 CTGACTAGGCAGATGCAGACGGG + Intronic
1035259347 7:157651892-157651914 CAGAGGAGGGAGAGGCAGGAAGG - Intronic
1035892623 8:3362205-3362227 CAGAGTAGGGATATGGTGGCTGG - Intronic
1037884340 8:22588539-22588561 GGGAGTACGGAGATGCAGGCTGG + Intronic
1038481034 8:27901942-27901964 GAAAATGGGGAGATGGAGGCTGG + Intronic
1038828363 8:31032491-31032513 CTGGATAGGGAGAGGCCGGCAGG - Exonic
1040654247 8:49486416-49486438 CAGAAAAGGGAGAGGCAAGCTGG - Intergenic
1040847221 8:51856022-51856044 AAGATTAGGGAGATCCAGGGTGG - Intronic
1041606502 8:59788190-59788212 GAGAATTGGGAGATGGAGGCAGG - Intergenic
1041654012 8:60330587-60330609 CAGGACAGGGAGATGCACCCTGG + Intergenic
1041830066 8:62143865-62143887 CAGAAGATGGAGATGCAGGCAGG + Intergenic
1041978542 8:63828285-63828307 CAGAAAAGGGAGATGAAGAAGGG + Intergenic
1042391541 8:68241330-68241352 CAGATTAGGGAGAAGGAGACAGG + Intergenic
1044352279 8:91180690-91180712 GAAAATAGGAAGATGAAGGCAGG + Intronic
1044577847 8:93790747-93790769 CAGAATAGGGAGTTTCAAGAAGG - Intronic
1047970734 8:130082100-130082122 CTGAAGAGGGAGAGGCTGGCAGG + Intronic
1047989550 8:130271575-130271597 AGAAATAGGGAGATGCAGGTTGG - Intronic
1048343222 8:133556424-133556446 CAGAGGAGTGAGATGCTGGCAGG + Intronic
1049607124 8:143534900-143534922 CTGAATGGGGCGATGCAGCCGGG - Intronic
1049829636 8:144692223-144692245 CAGAATAGCCAGATGAGGGCAGG - Intergenic
1050768185 9:9162600-9162622 GAGAAAATGGAGATGCAAGCAGG - Intronic
1052104903 9:24501491-24501513 CAGAATAGGAAGTTCCAGGAAGG - Intergenic
1052994524 9:34544124-34544146 CAGAAGAGGGAGAGGAAGGCAGG + Intergenic
1053576975 9:39363610-39363632 CAGCAAGGGAAGATGCAGGCAGG + Intergenic
1053841482 9:42191535-42191557 CAGCAAGGGAAGATGCAGGCAGG + Intergenic
1054098545 9:60922300-60922322 CAGCAAGGGAAGATGCAGGCAGG + Intergenic
1054119945 9:61197929-61197951 CAGCAAGGGAAGATGCAGGCAGG + Intergenic
1054587811 9:66984633-66984655 CAGCAAGGGAAGATGCAGGCAGG - Intergenic
1057055815 9:91959864-91959886 AAGAACAGAGAGAAGCAGGCTGG - Intergenic
1057836523 9:98449772-98449794 CAGAAGAGGGGGATGGAGGAGGG + Intronic
1057997293 9:99829563-99829585 CAGAGAAGGGAGATGGAGGCAGG + Intronic
1059302725 9:113328055-113328077 CAGAAGAAGGAGAAGCAAGCTGG + Intronic
1059750434 9:117242455-117242477 CAGAACAGGGATATGCTGGCTGG + Intronic
1059974818 9:119704613-119704635 TAGAAAAGGGAGATTCAGGTGGG + Intergenic
1060418463 9:123450053-123450075 AAAAAAAGGGAGATTCAGGCTGG + Intronic
1061175779 9:128995797-128995819 CACAAGAGGCAGATGCAGCCAGG - Intronic
1185668975 X:1790749-1790771 CAGAATAGTGAGTTTCAGCCAGG + Intergenic
1185826769 X:3258779-3258801 CAGAAATGGGAGAGGCAGGAAGG - Intergenic
1186439752 X:9575413-9575435 CAGAATAGGGAAATGCATAGGGG - Intronic
1188249164 X:27870877-27870899 GAGAATGGGGAGATGTAGGTTGG - Intergenic
1188878809 X:35466792-35466814 CTGACCAGGGAGATGCAGGTAGG + Intergenic
1189003788 X:36973853-36973875 CAGAATAGGGAGTTGGAGTGGGG + Intergenic
1189993045 X:46612629-46612651 TAGAAAACTGAGATGCAGGCCGG + Intronic
1192447684 X:71223051-71223073 CAGAACAGGTGGGTGCAGGCTGG + Intronic
1193963267 X:87951632-87951654 CAGAAACGGGAGATGCAGATGGG + Intergenic
1196289578 X:113923225-113923247 GAGTAAAGGGAGATGCAGGAGGG + Intergenic
1196855658 X:119981187-119981209 CAGAATAGCTAGTTGAAGGCAGG + Intergenic
1197388172 X:125826684-125826706 CAGAATAGGGAGCCACAAGCAGG - Intergenic
1197764301 X:130049953-130049975 CTTAAAAGGGAGAAGCAGGCTGG + Intronic
1201365862 Y:13205512-13205534 CAGAAAAGGGAGATGGGGGTGGG + Intergenic