ID: 924844014

View in Genome Browser
Species Human (GRCh38)
Location 1:247747186-247747208
Sequence TTCCTTGGACTACTATGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924844014_924844023 29 Left 924844014 1:247747186-247747208 CCTTTCCATAGTAGTCCAAGGAA No data
Right 924844023 1:247747238-247747260 CAAGCCTAGGCATCAAAGCCAGG No data
924844014_924844019 16 Left 924844014 1:247747186-247747208 CCTTTCCATAGTAGTCCAAGGAA No data
Right 924844019 1:247747225-247747247 ACCACTTCCACTCCAAGCCTAGG No data
924844014_924844024 30 Left 924844014 1:247747186-247747208 CCTTTCCATAGTAGTCCAAGGAA No data
Right 924844024 1:247747239-247747261 AAGCCTAGGCATCAAAGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924844014 Original CRISPR TTCCTTGGACTACTATGGAA AGG (reversed) Intergenic