ID: 924844285

View in Genome Browser
Species Human (GRCh38)
Location 1:247749880-247749902
Sequence AGTGGCTTTGTCTGTGTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924844285_924844292 19 Left 924844285 1:247749880-247749902 CCAACCACACAGACAAAGCCACT No data
Right 924844292 1:247749922-247749944 TGTTTCCAGGCTGACTCTCATGG No data
924844285_924844294 26 Left 924844285 1:247749880-247749902 CCAACCACACAGACAAAGCCACT No data
Right 924844294 1:247749929-247749951 AGGCTGACTCTCATGGACTATGG No data
924844285_924844290 6 Left 924844285 1:247749880-247749902 CCAACCACACAGACAAAGCCACT No data
Right 924844290 1:247749909-247749931 GCATCTGAGACCTTGTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924844285 Original CRISPR AGTGGCTTTGTCTGTGTGGT TGG (reversed) Intergenic